Incidental Mutation 'R5257:Gm21738'
ID472473
Institutional Source Beutler Lab
Gene Symbol Gm21738
Ensembl Gene ENSMUSG00000095280
Gene Namepredicted gene, 21738
Synonyms
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R5257 (G1)
Quality Score24.1
Status Validated
Chromosome14
Chromosomal Location19415857-19418930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19415942 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 199 (L199S)
Ref Sequence ENSEMBL: ENSMUSP00000137127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177817]
Predicted Effect probably benign
Transcript: ENSMUST00000177817
AA Change: L199S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137127
Gene: ENSMUSG00000095280
AA Change: L199S

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.11e-9 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 135 1.11e-9 PROSPERO
transmembrane domain 152 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Gm21738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm21738 APN 14 19418885 missense probably benign
IGL01010:Gm21738 APN 14 19417361 missense probably benign 0.03
IGL01018:Gm21738 APN 14 19418856 missense probably benign 0.39
IGL01865:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01869:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01873:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01877:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01878:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01879:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01880:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01882:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01883:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01884:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01885:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01886:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01888:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01891:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01892:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01893:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01894:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01895:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01896:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01898:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01899:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01900:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01901:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01902:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01903:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01904:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01905:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01906:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01908:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01909:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01910:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01911:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01912:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01913:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01914:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01915:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01916:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01917:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01918:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01919:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01922:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01923:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01924:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01925:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01926:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01932:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01940:Gm21738 APN 14 19416979 missense probably benign 0.01
IGL01949:Gm21738 APN 14 19416979 missense probably benign 0.01
PIT4131001:Gm21738 UTSW 14 19417330 missense probably benign 0.00
PIT4142001:Gm21738 UTSW 14 19417330 missense probably benign 0.00
R0831:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R0831:Gm21738 UTSW 14 19415963 missense probably benign
R0976:Gm21738 UTSW 14 19415963 missense probably benign
R1029:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R1146:Gm21738 UTSW 14 19415963 missense probably benign
R1231:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R1231:Gm21738 UTSW 14 19415963 missense probably benign
R1402:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R1402:Gm21738 UTSW 14 19415963 missense probably benign
R1638:Gm21738 UTSW 14 19418908 missense probably benign
R1874:Gm21738 UTSW 14 19418824 missense possibly damaging 0.64
R4392:Gm21738 UTSW 14 19417178 missense probably benign
R4393:Gm21738 UTSW 14 19417178 missense probably benign
R5049:Gm21738 UTSW 14 19415957 missense probably benign 0.01
R6756:Gm21738 UTSW 14 19418824 missense possibly damaging 0.64
R6915:Gm21738 UTSW 14 19415933 missense probably benign
V5622:Gm21738 UTSW 14 19417180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCGAGAAAACTGAAAATCACG -3'
(R):5'- AGTTTCTTGGCCATATTCCAGG -3'

Sequencing Primer
(F):5'- CGGAAAATGAGAAATACACACTTTAG -3'
(R):5'- TGGCCATATTCCAGGTACTACAG -3'
Posted On2017-04-10