Incidental Mutation 'R5278:Acvr2b'
ID472485
Institutional Source Beutler Lab
Gene Symbol Acvr2b
Ensembl Gene ENSMUSG00000061393
Gene Nameactivin receptor IIB
SynonymsActRIIB
MMRRC Submission 042865-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5278 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119402118-119434995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119432489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 383 (V383I)
Ref Sequence ENSEMBL: ENSMUSP00000126108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035093] [ENSMUST00000165044] [ENSMUST00000215746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035093
AA Change: V375I

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035093
Gene: ENSMUSG00000061393
AA Change: V375I

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.4e-13 PFAM
transmembrane domain 130 152 N/A INTRINSIC
Pfam:Pkinase 206 494 1.5e-55 PFAM
Pfam:Pkinase_Tyr 206 494 2.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165044
AA Change: V383I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126108
Gene: ENSMUSG00000061393
AA Change: V383I

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.3e-14 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Pkinase_Tyr 214 502 1.7e-26 PFAM
Pfam:Pkinase 217 501 1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213431
Predicted Effect possibly damaging
Transcript: ENSMUST00000215746
AA Change: V359I

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217621
Meta Mutation Damage Score 0.2833 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene show abnormal lateral asymmetry and homeotic transformation of the axial skeleton, and die shortly after birth with extensive cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 C T 5: 35,588,156 probably benign Het
Akap12 T C 10: 4,354,792 M534T probably benign Het
Akp3 G A 1: 87,125,166 E26K probably benign Het
Alcam A G 16: 52,274,275 I371T probably benign Het
Ap2a1 T C 7: 44,902,779 T794A probably benign Het
Apeh G A 9: 108,091,258 P349S probably benign Het
Asb7 G T 7: 66,679,185 Q36K possibly damaging Het
Asl A G 5: 130,018,831 probably null Het
Atp13a2 T A 4: 141,000,818 I574N probably damaging Het
Bcl2l2 T A 14: 54,884,794 I138N probably damaging Het
Cacna1d C T 14: 30,352,924 probably null Het
Ccdc9 C T 7: 16,278,381 W1* probably null Het
Cdh18 T A 15: 23,474,158 S705T probably benign Het
Ces5a A T 8: 93,525,638 W209R probably damaging Het
Chpf2 T A 5: 24,588,090 probably benign Het
Cul9 T A 17: 46,510,873 H1892L probably damaging Het
Cxcl13 A G 5: 95,958,727 T53A probably benign Het
Cyp2s1 T A 7: 25,805,884 Y385F possibly damaging Het
Ddx46 A G 13: 55,676,038 E915G probably damaging Het
Dirc2 A G 16: 35,697,988 S452P probably damaging Het
Elovl3 G A 19: 46,134,101 V113I probably benign Het
Fam53c A T 18: 34,762,618 probably benign Het
Fbxw15 A T 9: 109,555,684 F349L probably benign Het
Fuz C T 7: 44,896,277 P9L probably benign Het
Igf1r C T 7: 68,193,418 T759M possibly damaging Het
Impg2 G A 16: 56,221,517 D175N probably benign Het
Jade1 G T 3: 41,589,009 R43L possibly damaging Het
Kntc1 A G 5: 123,781,014 E816G probably damaging Het
Mettl8 A T 2: 70,973,297 D262E probably damaging Het
Mrpl48 A G 7: 100,552,583 V156A probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Myh13 A G 11: 67,334,564 I252V probably benign Het
Nox4 T C 7: 87,371,926 W449R probably damaging Het
Olfr167 A T 16: 19,515,378 L86* probably null Het
Olfr437 T C 6: 43,167,721 L221P probably damaging Het
Pank4 T C 4: 154,972,165 L351P probably damaging Het
Pappa2 A T 1: 158,782,403 probably null Het
Peg10 CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC CCATCAGGATGCACATCAGGATCC 6: 4,756,442 probably benign Het
Polr3e T A 7: 120,922,961 I10K possibly damaging Het
Prkdc T C 16: 15,714,974 I1489T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sh3pxd2b A G 11: 32,381,447 D57G probably damaging Het
Shank2 G A 7: 144,068,875 probably null Het
Slc15a4 A T 5: 127,616,969 V134E probably damaging Het
Stxbp5l G T 16: 37,186,654 Q726K probably benign Het
Tesk2 T G 4: 116,805,936 probably benign Het
Tex2 A G 11: 106,567,813 S264P probably benign Het
Tnik A G 3: 28,650,060 Q1003R probably damaging Het
Trip12 C T 1: 84,762,147 R628H probably damaging Het
Vmn2r69 G A 7: 85,411,783 H198Y probably benign Het
Other mutations in Acvr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Acvr2b APN 9 119432504 missense probably damaging 1.00
IGL02206:Acvr2b APN 9 119427998 nonsense probably null
IGL03022:Acvr2b APN 9 119427521 missense probably benign 0.10
IGL03131:Acvr2b APN 9 119431284 missense possibly damaging 0.92
R0455:Acvr2b UTSW 9 119432609 missense probably damaging 1.00
R2131:Acvr2b UTSW 9 119432808 missense probably damaging 1.00
R4744:Acvr2b UTSW 9 119431262 missense probably damaging 1.00
R5636:Acvr2b UTSW 9 119428309 missense probably damaging 1.00
R6196:Acvr2b UTSW 9 119433403 missense possibly damaging 0.71
R6253:Acvr2b UTSW 9 119428561 missense probably damaging 1.00
R6424:Acvr2b UTSW 9 119402579 missense probably benign
R6465:Acvr2b UTSW 9 119433303 missense probably damaging 1.00
R7096:Acvr2b UTSW 9 119428189 splice site probably null
R7102:Acvr2b UTSW 9 119432553 missense probably damaging 0.96
R7497:Acvr2b UTSW 9 119433286 missense probably benign
R8557:Acvr2b UTSW 9 119432588 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGGAATCTTCACTCTGCC -3'
(R):5'- CAGCATGTACTCATCGACAGG -3'

Sequencing Primer
(F):5'- TCACTCTGCCTCAAACGGGATG -3'
(R):5'- ATGTACTCATCGACAGGCCCTG -3'
Posted On2017-04-13