Incidental Mutation 'R4883:Herc4'
ID472498
Institutional Source Beutler Lab
Gene Symbol Herc4
Ensembl Gene ENSMUSG00000020064
Gene Namehect domain and RLD 4
Synonyms
MMRRC Submission 042491-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R4883 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63243810-63317878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63285654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 358 (S358T)
Ref Sequence ENSEMBL: ENSMUSP00000151886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020258] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020258
AA Change: S358T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064
AA Change: S358T

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218073
Predicted Effect probably benign
Transcript: ENSMUST00000219577
AA Change: S358T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220097
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display reduced male fertility associated with a high percentage of angulated sperm tails and impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,245,103 N52I probably damaging Het
Abca5 T C 11: 110,326,631 D133G probably damaging Het
Abcg4 G T 9: 44,279,319 H55Q probably damaging Het
Acaca T A 11: 84,251,290 V641E probably benign Het
Adam28 T C 14: 68,638,103 I229V probably damaging Het
Adgrl3 T A 5: 81,689,646 I793N probably damaging Het
Akr1d1 A T 6: 37,558,401 D240V possibly damaging Het
Arhgef25 T C 10: 127,182,933 D548G probably benign Het
Asl A G 5: 130,013,961 probably null Het
Atg14 C T 14: 47,551,314 R194Q probably damaging Het
BC004004 T A 17: 29,282,192 F38L probably damaging Het
Btg1 T C 10: 96,617,397 F25L probably benign Het
Btrc C T 19: 45,456,587 P35S probably benign Het
Calcr T A 6: 3,714,705 N142Y probably damaging Het
Ccdc138 A G 10: 58,561,996 I553V probably benign Het
Cdc42 T A 4: 137,328,804 N132I probably benign Het
Ces1e A G 8: 93,224,088 S22P probably benign Het
Clmn G T 12: 104,782,048 D413E probably benign Het
Cramp1l T C 17: 24,982,319 T730A probably benign Het
Dnah5 A T 15: 28,343,638 M2395L probably benign Het
Ephx1 G T 1: 181,001,923 S20Y possibly damaging Het
Exoc5 T G 14: 49,052,364 E19A probably damaging Het
Fam120b T C 17: 15,403,032 L424P probably benign Het
Fam89a G A 8: 124,741,084 T163I possibly damaging Het
Fcrls G A 3: 87,259,615 L24F possibly damaging Het
Fgd6 G T 10: 94,139,853 V1377L probably benign Het
Glud1 T A 14: 34,335,390 I337K possibly damaging Het
Gm6370 T A 5: 146,493,926 I303N probably benign Het
Gm7995 T C 14: 42,311,426 Y88H probably damaging Het
Gsdma3 T C 11: 98,629,567 probably null Het
Gsdmc2 T C 15: 63,835,765 D60G probably damaging Het
Hcn1 T A 13: 117,902,895 probably null Het
Hectd1 A T 12: 51,784,247 C936* probably null Het
Hk3 A G 13: 55,010,922 C515R probably benign Het
Ighg1 A G 12: 113,327,518 probably benign Het
Iqgap3 T A 3: 88,107,535 C853S probably benign Het
Irx4 G A 13: 73,267,631 A180T probably damaging Het
Kif20b A G 19: 34,966,122 T1441A probably benign Het
Lifr A G 15: 7,185,625 K738E possibly damaging Het
Lmntd2 A T 7: 141,212,618 S218T probably damaging Het
Lnx1 A T 5: 74,607,869 W353R probably benign Het
Lrfn3 G T 7: 30,355,813 P569Q possibly damaging Het
Mamstr A G 7: 45,644,414 I11V probably benign Het
Med31 T C 11: 72,214,149 N32S possibly damaging Het
Mob3c A T 4: 115,833,731 I173F probably benign Het
Morc3 A G 16: 93,870,362 probably null Het
Mphosph9 T C 5: 124,299,045 K412R probably damaging Het
Mthfd1l C T 10: 4,007,775 P271S probably benign Het
Ncam1 C T 9: 49,541,883 probably null Het
Ncbp3 T A 11: 73,069,752 Y279N probably damaging Het
Ncoa6 G A 2: 155,406,767 T1539I probably benign Het
Nedd4 G A 9: 72,740,233 probably null Het
Neil1 A G 9: 57,146,922 V38A probably damaging Het
Ngf T A 3: 102,520,645 F237I probably damaging Het
Nol3 A G 8: 105,279,256 Q94R possibly damaging Het
Obox1 A G 7: 15,556,338 N202S probably damaging Het
Odc1 T A 12: 17,547,385 N29K possibly damaging Het
Olfr1241 C T 2: 89,482,308 V276I probably benign Het
Olfr132 T C 17: 38,130,617 T192A probably damaging Het
Olfr1535 C T 13: 21,555,488 R178H probably benign Het
Olfr243 A C 7: 103,716,707 I38L probably benign Het
P2rx7 T A 5: 122,681,066 V517E probably damaging Het
Parm1 A G 5: 91,593,916 T48A possibly damaging Het
Pcdh9 T A 14: 93,888,728 D2V possibly damaging Het
Pgm3 G T 9: 86,569,325 T92N probably damaging Het
Plcg2 G T 8: 117,607,133 G882* probably null Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Ptprk A T 10: 28,588,932 Y1244F probably damaging Het
Rere G A 4: 150,616,053 A1162T probably damaging Het
Rfx2 T C 17: 56,783,747 E391G probably damaging Het
Sema4c A G 1: 36,552,016 V414A probably damaging Het
Serpinb10 A T 1: 107,540,951 N185I probably damaging Het
Shroom3 T G 5: 92,951,134 M1410R probably benign Het
Slc13a1 A T 6: 24,134,357 S176T probably benign Het
Sntb1 A T 15: 55,642,802 Y458* probably null Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Sorcs1 C T 19: 50,232,303 V570I probably benign Het
Sp8 T A 12: 118,849,070 V220E probably damaging Het
Spry1 C T 3: 37,642,719 T37M possibly damaging Het
Sspo A T 6: 48,460,822 H1305L probably benign Het
Tbc1d22a A G 15: 86,496,916 D509G possibly damaging Het
Tmem108 A T 9: 103,499,077 V391D possibly damaging Het
Tmem132d T A 5: 128,269,300 I53F probably damaging Het
Tmem132d T A 5: 128,269,302 H52L possibly damaging Het
Tnnt2 A T 1: 135,847,758 R87* probably null Het
Ube3a A T 7: 59,243,450 M1L probably benign Het
Unc79 A G 12: 103,094,333 T1119A probably damaging Het
Usf3 A T 16: 44,219,579 H1474L probably damaging Het
Vcpip1 G A 1: 9,747,198 T320I probably damaging Het
Vmn1r56 A G 7: 5,196,444 L58P probably damaging Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Zbtb40 T A 4: 137,000,930 R459W probably benign Het
Zfc3h1 T A 10: 115,410,642 L878Q probably damaging Het
Zfp286 T C 11: 62,780,629 D206G probably benign Het
Zfp46 T A 4: 136,290,481 C209S probably damaging Het
Zufsp G T 10: 33,949,042 T148K probably damaging Het
Other mutations in Herc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Herc4 APN 10 63273537 missense probably benign 0.01
IGL00977:Herc4 APN 10 63311567 missense probably damaging 1.00
IGL01455:Herc4 APN 10 63286143 critical splice donor site probably null
IGL01615:Herc4 APN 10 63290682 splice site probably benign
IGL01974:Herc4 APN 10 63299241 critical splice donor site probably null
IGL02207:Herc4 APN 10 63299244 splice site probably null
IGL02215:Herc4 APN 10 63273566 missense probably benign
IGL02331:Herc4 APN 10 63264160 missense probably benign
IGL02407:Herc4 APN 10 63306424 missense probably damaging 0.96
IGL02444:Herc4 APN 10 63306433 missense probably benign 0.00
IGL02498:Herc4 APN 10 63273465 missense probably benign 0.01
IGL02797:Herc4 APN 10 63316807 splice site probably null
IGL02804:Herc4 APN 10 63285675 missense probably benign 0.10
Boosted UTSW 10 63264171 nonsense probably null
Factorial UTSW 10 63286068 missense probably benign 0.00
handout UTSW 10 63315658 critical splice acceptor site probably null
R0499:Herc4 UTSW 10 63264032 missense probably damaging 1.00
R0655:Herc4 UTSW 10 63273571 missense probably benign 0.33
R0722:Herc4 UTSW 10 63286065 missense probably null 0.56
R0738:Herc4 UTSW 10 63289149 missense possibly damaging 0.93
R1742:Herc4 UTSW 10 63287949 missense probably benign 0.16
R1776:Herc4 UTSW 10 63264171 nonsense probably null
R1792:Herc4 UTSW 10 63245901 start codon destroyed probably null 1.00
R1968:Herc4 UTSW 10 63273525 missense probably benign 0.43
R1992:Herc4 UTSW 10 63245964 missense possibly damaging 0.50
R2012:Herc4 UTSW 10 63244038 start gained probably benign
R2077:Herc4 UTSW 10 63264053 missense probably benign 0.04
R2103:Herc4 UTSW 10 63246110 missense probably benign 0.00
R2363:Herc4 UTSW 10 63315694 missense possibly damaging 0.96
R3833:Herc4 UTSW 10 63245960 missense probably benign
R4014:Herc4 UTSW 10 63287544 missense probably benign
R4084:Herc4 UTSW 10 63283237 missense probably damaging 1.00
R4855:Herc4 UTSW 10 63315658 critical splice acceptor site probably null
R5215:Herc4 UTSW 10 63289097 missense probably benign 0.22
R5330:Herc4 UTSW 10 63307799 nonsense probably null
R5331:Herc4 UTSW 10 63307799 nonsense probably null
R5429:Herc4 UTSW 10 63275013 missense probably benign 0.01
R6058:Herc4 UTSW 10 63275042 missense possibly damaging 0.80
R6462:Herc4 UTSW 10 63289101 missense probably benign
R6502:Herc4 UTSW 10 63317418 missense probably benign 0.00
R6669:Herc4 UTSW 10 63286068 missense probably benign 0.00
R7161:Herc4 UTSW 10 63308415 missense probably benign 0.35
R7267:Herc4 UTSW 10 63273586 missense possibly damaging 0.64
R7740:Herc4 UTSW 10 63269678 missense probably benign 0.02
R8515:Herc4 UTSW 10 63315786 missense probably benign 0.00
R8896:Herc4 UTSW 10 63311507 missense possibly damaging 0.61
Z1176:Herc4 UTSW 10 63307749 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAAAGGCTCACAAACTTGC -3'
(R):5'- GGAAAACAAATTTGGACAGTTGACC -3'

Sequencing Primer
(F):5'- AACTTGCCAATGGTGCCTAG -3'
(R):5'- ACAAATTTGGACAGTTGACCTATAAC -3'
Posted On2017-04-14