Incidental Mutation 'R0503:Zfp940'
Institutional Source Beutler Lab
Gene Symbol Zfp940
Ensembl Gene ENSMUSG00000050855
Gene Namezinc finger protein 940
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosomal Location29833620-29853669 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 29846020 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085792] [ENSMUST00000108223]
Predicted Effect unknown
Transcript: ENSMUST00000085792
AA Change: V154A
SMART Domains Protein: ENSMUSP00000082947
Gene: ENSMUSG00000050855
AA Change: V154A

KRAB 6 66 1.05e-31 SMART
ZnF_C2H2 251 273 3.69e-4 SMART
ZnF_C2H2 279 301 5.5e-3 SMART
ZnF_C2H2 307 329 7.67e-2 SMART
ZnF_C2H2 340 362 2.71e-2 SMART
ZnF_C2H2 368 390 5.34e-1 SMART
ZnF_C2H2 396 418 1.38e-3 SMART
ZnF_C2H2 424 446 3.39e-3 SMART
ZnF_C2H2 452 474 6.78e-3 SMART
ZnF_C2H2 485 507 4.79e-3 SMART
ZnF_C2H2 513 535 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108223
SMART Domains Protein: ENSMUSP00000103858
Gene: ENSMUSG00000050855

KRAB 6 67 2.42e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145098
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Zfp940
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Zfp940 APN 7 29846870 missense probably damaging 1.00
IGL02092:Zfp940 APN 7 29846201 missense probably benign
IGL02498:Zfp940 APN 7 29846951 missense probably damaging 0.97
R0614:Zfp940 UTSW 7 29846246 missense probably benign 0.03
R1604:Zfp940 UTSW 7 29846075 missense probably benign
R1619:Zfp940 UTSW 7 29845537 missense possibly damaging 0.85
R1715:Zfp940 UTSW 7 29844938 missense probably damaging 0.96
R1749:Zfp940 UTSW 7 29845527 nonsense probably null
R1862:Zfp940 UTSW 7 29845010 missense probably damaging 1.00
R4017:Zfp940 UTSW 7 29845934 missense probably benign
R4673:Zfp940 UTSW 7 29845438 missense probably benign 0.00
R4761:Zfp940 UTSW 7 29846153 missense probably benign 0.12
R4890:Zfp940 UTSW 7 29845399 missense probably benign 0.01
R5027:Zfp940 UTSW 7 29850956 utr 5 prime probably benign
R5285:Zfp940 UTSW 7 29845600 missense probably damaging 0.99
R5340:Zfp940 UTSW 7 29844841 missense probably benign 0.33
R5439:Zfp940 UTSW 7 29845433 missense probably benign 0.02
R5983:Zfp940 UTSW 7 29845052 missense possibly damaging 0.96
R7873:Zfp940 UTSW 7 29835617 missense unknown
R7956:Zfp940 UTSW 7 29835617 missense unknown
R8035:Zfp940 UTSW 7 29845523 missense probably benign 0.18
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tggggaggaaagggtttattg -3'
Posted On2013-06-12