Mutagenetix > Incidental Mutations

Incidental Mutation 'R4899:Cacna2d4'

472511

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d4

Ensembl Gene

ENSMUSG00000041460

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 4

Synonyms

5730412N02Rik

MMRRC Submission

042503-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119236526-119352407 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 119268196 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 288 (W288*)

Ref Sequence

ENSEMBL: ENSMUSP00000140197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]

Predicted Effect

probably null
Transcript: ENSMUST00000037434
AA Change: W288*

SMART Domains

Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460
AA Change: W288*

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	7.3e-40	PFAM
VWA	296	481	4.37e-14	SMART
Pfam:Cache_1	494	586	1.1e-24	PFAM
low complexity region	837	849	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1000	1011	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186176

Predicted Effect

probably null
Transcript: ENSMUST00000186622
AA Change: W288*

SMART Domains

Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460
AA Change: W288*

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	6.4e-44	PFAM
VWA	296	481	2.7e-16	SMART
Pfam:Cache_1	494	559	1.1e-7	PFAM
low complexity region	812	824	N/A	INTRINSIC
low complexity region	950	959	N/A	INTRINSIC
low complexity region	975	986	N/A	INTRINSIC
low complexity region	1095	1118	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188239

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191331

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010005H15Rik	A	T	16: 36,257,365	Y96F	possibly damaging	Het
9230110C19Rik	A	T	9: 8,022,493	S243T	possibly damaging	Het
Abhd18	C	G	3: 40,905,869		probably null	Het
Adra2c	A	T	5: 35,280,361	Y159F	probably damaging	Het
AI481877	T	C	4: 59,062,640	Y872C	probably damaging	Het
Alkal2	T	A	12: 30,884,973	S64T	probably benign	Het
Apbb1ip	T	C	2: 22,823,349	V72A	unknown	Het
Atp13a5	A	G	16: 29,378,500	L13P	probably damaging	Het
Azin2	G	A	4: 128,934,653	P254S	probably benign	Het
Bmpr1b	T	C	3: 141,840,683	R481G	probably damaging	Het
Cass4	A	G	2: 172,427,869	T626A	probably benign	Het
Cep112	T	A	11: 108,606,284	D683E	probably damaging	Het
Chat	G	T	14: 32,448,977	S188R	possibly damaging	Het
Cit	A	G	5: 115,863,028	Y162C	possibly damaging	Het
Clca3a1	T	A	3: 144,737,961	Y676F	probably damaging	Het
Clec2h	A	G	6: 128,675,824	N185D	probably benign	Het
Cnbd2	G	T	2: 156,339,221	V192F	probably benign	Het
Col6a3	C	A	1: 90,802,427	G1112V	probably damaging	Het
Cyp3a25	A	G	5: 145,977,671	F483S	possibly damaging	Het
Dscam	T	C	16: 96,683,818	E1103G	probably benign	Het
Dync2h1	G	A	9: 7,131,921	Q1629*	probably null	Het
E330014E10Rik	T	C	5: 95,801,727	V111A	probably benign	Het
Enpp6	A	G	8: 46,987,083	Y38C	probably damaging	Het
Epg5	T	A	18: 77,985,057	L1271Q	probably damaging	Het
Fam47e	G	A	5: 92,574,669	V75I	probably benign	Het
Fat3	T	C	9: 15,969,799	D3259G	probably damaging	Het
Fbxw28	T	C	9: 109,330,853	D211G	probably damaging	Het
Flnc	A	G	6: 29,446,843	N990D	probably benign	Het
Frat1	T	G	19: 41,830,322	L52R	probably damaging	Het
Ftmt	C	G	18: 52,331,586		probably benign	Het
H2-M1	C	T	17: 36,671,220	G163D	probably benign	Het
Hapln1	A	G	13: 89,601,650	K105E	possibly damaging	Het
Igkv17-127	G	T	6: 67,861,397	A31S	probably benign	Het
Il6st	T	C	13: 112,501,161	L628P	probably damaging	Het
Kcnj6	A	G	16: 94,832,613	I213T	probably damaging	Het
Kidins220	T	C	12: 25,013,443		probably null	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Marc2	A	T	1: 184,845,624	I65N	probably damaging	Het
Mertk	C	A	2: 128,783,925	P660Q	probably damaging	Het
Mkl1	A	G	15: 81,018,386	Y241H	probably damaging	Het
Napepld	A	G	5: 21,683,440	Y4H	probably benign	Het
Ncam1	T	A	9: 49,545,251		probably null	Het
Nuak2	A	T	1: 132,324,986	K93*	probably null	Het
Oat	A	T	7: 132,564,222	D211E	probably benign	Het
Olfr1214	A	C	2: 88,988,110	L31V	probably null	Het
Olfr1355	A	T	10: 78,879,207	S12C	probably benign	Het
Olfr171	G	A	16: 19,624,200	A300V	probably benign	Het
Olfr348	A	G	2: 36,786,798	Q91R	probably benign	Het
Olfr64	A	G	7: 103,893,465	I90T	possibly damaging	Het
Pde4dip	C	A	3: 97,709,558	K1789N	probably damaging	Het
Piezo2	T	C	18: 63,078,791	I1322V	possibly damaging	Het
Pih1d1	A	G	7: 45,154,527		probably benign	Het
Plekhd1	T	C	12: 80,722,327	S454P	probably damaging	Het
Polr2h	G	A	16: 20,720,553	V89M	probably damaging	Het
Pptc7	G	A	5: 122,284,717	G17S	possibly damaging	Het
Ptpra	T	C	2: 130,544,436	V602A	probably damaging	Het
Rnf123	C	T	9: 108,063,680	R654H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	A	G	16: 75,879,103	S135P	probably damaging	Het
Sgsm3	A	G	15: 81,006,779	N147S	probably benign	Het
Slc22a29	T	C	19: 8,161,569	T510A	probably benign	Het
Smc4	T	A	3: 69,031,811	H978Q	probably damaging	Het
Sox7	G	A	14: 63,948,478	R321H	probably damaging	Het
Spred3	T	C	7: 29,161,833	D307G	probably damaging	Het
Syne2	T	A	12: 75,854,101	D11E	probably benign	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,214,452		probably benign	Het
Top2b	A	T	14: 16,387,313	I134F	probably damaging	Het
Tspan1	T	A	4: 116,163,366	R206*	probably null	Het
Ttc3	A	T	16: 94,429,455	N837I	probably damaging	Het
Vmn1r36	T	C	6: 66,716,565	T72A	possibly damaging	Het
Vmn2r10	A	G	5: 109,003,458	S97P	probably damaging	Het
Zfp2	T	A	11: 50,900,014	I401F	probably damaging	Het
Zfp629	T	C	7: 127,611,018	T540A	possibly damaging	Het
Zfr	G	A	15: 12,166,145	V834I	probably benign	Het

Other mutations in Cacna2d4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Cacna2d4	APN	6	119337933	splice site	probably benign
IGL00469:Cacna2d4	APN	6	119268278	missense	probably damaging	1.00
IGL00518:Cacna2d4	APN	6	119343575	missense	probably damaging	1.00
IGL00946:Cacna2d4	APN	6	119271915	missense	possibly damaging	0.82
IGL01447:Cacna2d4	APN	6	119242904	missense	probably damaging	1.00
IGL01514:Cacna2d4	APN	6	119282173	splice site	probably benign
IGL01576:Cacna2d4	APN	6	119281641	nonsense	probably null
IGL01934:Cacna2d4	APN	6	119308768	missense	probably damaging	1.00
IGL02231:Cacna2d4	APN	6	119277908	splice site	probably benign
IGL02516:Cacna2d4	APN	6	119271870	splice site	probably benign
IGL02688:Cacna2d4	APN	6	119270749	splice site	probably null
IGL03110:Cacna2d4	APN	6	119236737	missense	probably benign	0.05
IGL03365:Cacna2d4	APN	6	119271264	missense	probably benign	0.15
saccharine	UTSW	6	119345106	splice site	probably benign
Steveo	UTSW	6	119347252	critical splice donor site	probably null
Sussmann	UTSW	6	119274318	missense	probably damaging	1.00
R0139:Cacna2d4	UTSW	6	119278269	intron	probably benign
R0157:Cacna2d4	UTSW	6	119312424	missense	probably benign	0.00
R0158:Cacna2d4	UTSW	6	119236748	missense	possibly damaging	0.68
R0245:Cacna2d4	UTSW	6	119308721	missense	probably damaging	1.00
R0612:Cacna2d4	UTSW	6	119281718	splice site	probably benign
R0659:Cacna2d4	UTSW	6	119345106	splice site	probably benign
R0722:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0743:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0833:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0835:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0836:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0884:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1052:Cacna2d4	UTSW	6	119300333	missense	probably damaging	1.00
R1168:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1170:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1451:Cacna2d4	UTSW	6	119236824	missense	probably benign	0.01
R1564:Cacna2d4	UTSW	6	119241195	missense	possibly damaging	0.67
R1809:Cacna2d4	UTSW	6	119270824	missense	probably damaging	0.99
R1936:Cacna2d4	UTSW	6	119270761	missense	possibly damaging	0.82
R2078:Cacna2d4	UTSW	6	119338116	missense	probably benign	0.02
R2198:Cacna2d4	UTSW	6	119347259	splice site	probably benign
R2280:Cacna2d4	UTSW	6	119350041	missense	possibly damaging	0.85
R3757:Cacna2d4	UTSW	6	119241163	missense	probably damaging	0.98
R3975:Cacna2d4	UTSW	6	119278173	splice site	probably null
R3976:Cacna2d4	UTSW	6	119278173	splice site	probably null
R4238:Cacna2d4	UTSW	6	119240708	missense	probably null	1.00
R4591:Cacna2d4	UTSW	6	119298464	missense	probably benign	0.02
R4856:Cacna2d4	UTSW	6	119278256	missense	possibly damaging	0.90
R5319:Cacna2d4	UTSW	6	119347252	critical splice donor site	probably null
R5351:Cacna2d4	UTSW	6	119268201	missense	probably damaging	1.00
R5366:Cacna2d4	UTSW	6	119274318	missense	probably damaging	1.00
R5393:Cacna2d4	UTSW	6	119239054	missense	probably benign	0.20
R5395:Cacna2d4	UTSW	6	119271418	missense	possibly damaging	0.71
R5408:Cacna2d4	UTSW	6	119348791	missense	probably damaging	1.00
R5603:Cacna2d4	UTSW	6	119244285	missense	probably damaging	1.00
R5661:Cacna2d4	UTSW	6	119343531	missense	probably benign
R5898:Cacna2d4	UTSW	6	119274231	missense	probably damaging	1.00
R5928:Cacna2d4	UTSW	6	119281698	missense	probably benign	0.06
R6186:Cacna2d4	UTSW	6	119281689	missense	possibly damaging	0.94
R6218:Cacna2d4	UTSW	6	119239060	missense	probably damaging	0.99
R6257:Cacna2d4	UTSW	6	119281619	critical splice acceptor site	probably null
R6409:Cacna2d4	UTSW	6	119282228	missense	probably damaging	0.99
R6931:Cacna2d4	UTSW	6	119282234	missense	possibly damaging	0.49
R7221:Cacna2d4	UTSW	6	119236663	missense	probably benign	0.02
R7363:Cacna2d4	UTSW	6	119343978	missense	probably damaging	1.00
R7371:Cacna2d4	UTSW	6	119308709	missense	probably benign	0.07
R7382:Cacna2d4	UTSW	6	119239087	missense	probably damaging	1.00
R7431:Cacna2d4	UTSW	6	119244276	missense	probably damaging	0.98
R7517:Cacna2d4	UTSW	6	119271921	missense	probably benign	0.01
R7527:Cacna2d4	UTSW	6	119271247	missense	probably benign	0.00
R7529:Cacna2d4	UTSW	6	119270766	missense	probably benign	0.01
R7710:Cacna2d4	UTSW	6	119274239	missense	probably benign	0.05
R7880:Cacna2d4	UTSW	6	119349155	missense	probably damaging	0.99
R8007:Cacna2d4	UTSW	6	119312444	missense	probably benign
R8084:Cacna2d4	UTSW	6	119300352	missense	probably damaging	1.00
R8159:Cacna2d4	UTSW	6	119297527	missense	probably benign	0.01
R8391:Cacna2d4	UTSW	6	119348745	missense	probably benign	0.04
RF023:Cacna2d4	UTSW	6	119268230	missense	probably benign	0.19
Z1176:Cacna2d4	UTSW	6	119312450	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- AGGCTTACTTCCAATCTCAGC -3'
(R):5'- TGCAATCTGAGCACAACAATGG -3'

Sequencing Primer
(F):5'- TTACTTCCAATCTCAGCACCCCAG -3'
(R):5'- TATTTTCCCAGAGCAGGTGAGAGC -3'

Posted On

2017-04-14