Incidental Mutation 'R4899:Rnf123'
ID 472512
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 042503-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R4899 (G1)
Quality Score 205
Status Not validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108063680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 654 (R654H)
Ref Sequence ENSEMBL: ENSMUSP00000125495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: R660H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: R660H

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: R654H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: R654H

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: R654H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: R654H

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: R660H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: R660H

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: R654H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: R654H

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCAGTGAGCGAACTTTGAC -3'
(R):5'- GACAGGTAGAGGCTGCTTCATG -3'

Sequencing Primer
(F):5'- GACTTTCTCCATGGTGCTCAGAAG -3'
(R):5'- CTGTAGGCAGGGGTATGACC -3'
Posted On 2017-04-14