Incidental Mutation 'R0503:Mphosph10'
ID47253
Institutional Source Beutler Lab
Gene Symbol Mphosph10
Ensembl Gene ENSMUSG00000030521
Gene NameM-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Synonyms
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64376527-64392268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64389893 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 110 (C110S)
Ref Sequence ENSEMBL: ENSMUSP00000032735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000037205] [ENSMUST00000206194] [ENSMUST00000206882]
Predicted Effect probably benign
Transcript: ENSMUST00000032735
AA Change: C110S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521
AA Change: C110S

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037205
SMART Domains Protein: ENSMUSP00000047855
Gene: ENSMUSG00000033429

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Glyoxalase 49 175 2.7e-14 PFAM
Pfam:Glyoxalase_3 50 166 5.1e-9 PFAM
Pfam:Glyoxalase_4 51 162 1.2e-20 PFAM
Pfam:Glyoxalase_2 55 175 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206138
Predicted Effect probably benign
Transcript: ENSMUST00000206194
Predicted Effect probably benign
Transcript: ENSMUST00000206882
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Mphosph10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mphosph10 APN 7 64389755 missense probably benign 0.00
IGL02113:Mphosph10 APN 7 64376807 unclassified probably benign
IGL02615:Mphosph10 APN 7 64381045 splice site probably benign
R0280:Mphosph10 UTSW 7 64376703 missense possibly damaging 0.92
R0372:Mphosph10 UTSW 7 64388855 unclassified probably benign
R0548:Mphosph10 UTSW 7 64378800 missense probably benign 0.45
R1158:Mphosph10 UTSW 7 64388859 unclassified probably benign
R1271:Mphosph10 UTSW 7 64390084 splice site probably null
R1447:Mphosph10 UTSW 7 64380950 missense probably damaging 1.00
R1501:Mphosph10 UTSW 7 64389504 missense probably damaging 1.00
R1815:Mphosph10 UTSW 7 64392170 missense probably benign 0.05
R1900:Mphosph10 UTSW 7 64381028 missense possibly damaging 0.61
R1997:Mphosph10 UTSW 7 64387447 critical splice donor site probably null
R2058:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2059:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2292:Mphosph10 UTSW 7 64385771 missense probably damaging 1.00
R4658:Mphosph10 UTSW 7 64388974 splice site probably null
R4817:Mphosph10 UTSW 7 64392221 unclassified probably benign
R4968:Mphosph10 UTSW 7 64382908 missense probably damaging 1.00
R5121:Mphosph10 UTSW 7 64389596 missense probably damaging 1.00
R5187:Mphosph10 UTSW 7 64385820 missense possibly damaging 0.49
R5304:Mphosph10 UTSW 7 64388984 missense probably damaging 1.00
R5469:Mphosph10 UTSW 7 64389445 critical splice donor site probably null
R6179:Mphosph10 UTSW 7 64378781 missense possibly damaging 0.66
R6360:Mphosph10 UTSW 7 64389955 missense probably benign 0.00
R6632:Mphosph10 UTSW 7 64385819 missense probably damaging 1.00
R6996:Mphosph10 UTSW 7 64388921 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTTAATCTTCTGCCGCCCAAACAG -3'
(R):5'- GGCCGAATCTCTGGAAGTCCTTTAC -3'

Sequencing Primer
(F):5'- tcttcctcgtcctcctcttc -3'
(R):5'- CTCTGGAAGTCCTTTACAGAAACTTG -3'
Posted On2013-06-12