Incidental Mutation 'R0503:Olfr523'
ID47255
Institutional Source Beutler Lab
Gene Symbol Olfr523
Ensembl Gene ENSMUSG00000051051
Gene Nameolfactory receptor 523
SynonymsMOR104-4, GA_x6K02T2PBJ9-42327937-42328872
MMRRC Submission 038698-MU
Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0503 (G1)
Quality Score192
Status Validated
Chromosome7
Chromosomal Location140173217-140178758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140176441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 113 (V113A)
Ref Sequence ENSEMBL: ENSMUSP00000052678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055890
AA Change: V113A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: V113A

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_4 40 317 1.6e-50 PFAM
Pfam:7tm_1 50 299 1.6e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209314
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213953
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214272
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215785
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216023
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Olfr523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr523 APN 7 140176615 missense probably damaging 1.00
IGL01759:Olfr523 APN 7 140176534 missense probably benign 0.00
D3080:Olfr523 UTSW 7 140176362 missense possibly damaging 0.94
R1644:Olfr523 UTSW 7 140176648 missense probably benign 0.12
R1760:Olfr523 UTSW 7 140176275 missense probably damaging 1.00
R1852:Olfr523 UTSW 7 140176561 nonsense probably null
R1960:Olfr523 UTSW 7 140176683 missense probably benign 0.37
R2363:Olfr523 UTSW 7 140176965 missense probably damaging 1.00
R3700:Olfr523 UTSW 7 140176214 missense possibly damaging 0.54
R4626:Olfr523 UTSW 7 140176446 missense probably damaging 1.00
R4678:Olfr523 UTSW 7 140176228 missense probably benign 0.21
R4779:Olfr523 UTSW 7 140176450 missense probably damaging 1.00
R4999:Olfr523 UTSW 7 140177020 missense probably damaging 1.00
R5663:Olfr523 UTSW 7 140176321 missense probably damaging 1.00
R7352:Olfr523 UTSW 7 140176525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCATTCATCTTGCTGGGCTTC -3'
(R):5'- GCACTATCCAGGGCGAAATGTCAC -3'

Sequencing Primer
(F):5'- TCTGCTTACAGTAGCTGGAAACC -3'
(R):5'- TCACAGAAGAAGTGGTTGATGAC -3'
Posted On2013-06-12