Mutagenetix > Incidental Mutations

Incidental Mutation 'R0503:Olfr523'

47255

Institutional Source

Beutler Lab

Gene Symbol

Olfr523

Ensembl Gene

ENSMUSG00000051051

Gene Name

olfactory receptor 523

Synonyms

MOR104-4, GA_x6K02T2PBJ9-42327937-42328872

MMRRC Submission

038698-MU

Accession Numbers

Genbank: NM_146518; MGI: 3030357

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R0503 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

140173217-140178758 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140176441 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 113 (V113A)

Ref Sequence

ENSEMBL: ENSMUSP00000052678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055890] [ENSMUST00000209314] [ENSMUST00000213953] [ENSMUST00000214272] [ENSMUST00000215785] [ENSMUST00000216023]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055890
AA Change: V113A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000052678
Gene: ENSMUSG00000051051
AA Change: V113A

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:7tm_4	40	317	1.6e-50	PFAM
Pfam:7tm_1	50	299	1.6e-23	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209314
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213953
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214272
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215785
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216023
AA Change: V107A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1922

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,495	H755R	possibly damaging	Het
Atp2c2	A	G	8: 119,734,577	E279G	probably null	Het
Ccdc65	G	T	15: 98,709,160	D83Y	probably damaging	Het
Cd200r2	T	A	16: 44,877,962	M1K	probably null	Het
Clca4c-ps	A	T	3: 144,879,822		noncoding transcript	Het
Col6a6	A	T	9: 105,767,351	M1246K	probably benign	Het
Comp	A	T	8: 70,375,734	N130I	possibly damaging	Het
Crot	A	G	5: 8,976,075	V304A	possibly damaging	Het
Dapk1	T	A	13: 60,730,848		probably null	Het
Dspp	A	T	5: 104,177,256	D495V	unknown	Het
Erich2	C	A	2: 70,540,775	S426R	unknown	Het
Erich2	A	T	2: 70,509,699	R169S	probably damaging	Het
Gab1	C	T	8: 80,800,142	R109H	probably damaging	Het
Ggcx	GTCTAT	GTCTATCTAT	6: 72,429,157		probably null	Het
Gria1	T	G	11: 57,189,716	V175G	probably damaging	Het
Hmcn1	C	T	1: 150,859,252	V170M	probably damaging	Het
Irx4	T	A	13: 73,266,584		probably null	Het
Katnb1	A	G	8: 95,095,174	T212A	probably damaging	Het
Kirrel	A	G	3: 87,097,802	S80P	probably benign	Het
Lrrc75b	T	C	10: 75,553,654	T81A	possibly damaging	Het
Macf1	A	G	4: 123,469,815	S1775P	probably damaging	Het
Mmp10	A	T	9: 7,507,339	I387F	probably damaging	Het
Mphosph10	A	T	7: 64,389,893	C110S	probably benign	Het
Mpig6b	A	G	17: 35,064,448		probably benign	Het
Mrps27	G	T	13: 99,409,795		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mybpc2	A	G	7: 44,512,570		probably benign	Het
Nbea	C	T	3: 55,642,836	G2724S	possibly damaging	Het
Nck2	A	G	1: 43,533,568	M1V	probably null	Het
Nefl	T	A	14: 68,083,983	D7E	probably benign	Het
Nktr	T	A	9: 121,750,740		probably benign	Het
Nlrp12	C	T	7: 3,249,377	E55K	probably damaging	Het
Nsun7	T	A	5: 66,283,581		probably benign	Het
Olfr1214	C	T	2: 88,987,978	V75I	probably benign	Het
Olfr586	A	T	7: 103,122,436	M112K	possibly damaging	Het
Olfr729	T	A	14: 50,148,478	Y132F	probably damaging	Het
Olfr769	T	C	10: 129,111,802	T208A	probably damaging	Het
Olfr961	A	G	9: 39,647,476	Y250C	probably damaging	Het
Pcdh15	A	G	10: 74,210,385	T165A	probably damaging	Het
Pikfyve	A	T	1: 65,219,899	H410L	probably damaging	Het
Polr3c	A	T	3: 96,713,636		probably null	Het
Ptdss2	T	A	7: 141,151,797		probably benign	Het
Ptprg	A	G	14: 12,237,138	M1386V	possibly damaging	Het
Ptpru	T	C	4: 131,793,643	N784S	probably benign	Het
Rfx4	T	A	10: 84,894,332	I495K	possibly damaging	Het
Serpina12	C	A	12: 104,031,159	A368S	probably damaging	Het
Tmem39b	A	C	4: 129,686,986	Y238D	possibly damaging	Het
Tspan11	T	C	6: 127,939,112	W124R	probably benign	Het
Ttll10	T	C	4: 156,047,548		probably benign	Het
Tyro3	T	C	2: 119,803,230		probably benign	Het
Unc79	A	G	12: 103,078,868	M644V	probably benign	Het
Vmn1r196	G	A	13: 22,293,387	M65I	probably benign	Het
Vmn2r85	T	C	10: 130,422,740	Y482C	probably damaging	Het
Zfp940	A	G	7: 29,846,020		probably benign	Het
Zfyve9	A	T	4: 108,719,764	L40*	probably null	Het
Zkscan1	T	A	5: 138,093,326	I107N	probably damaging	Het

Other mutations in Olfr523

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01288:Olfr523	APN	7	140176615	missense	probably damaging	1.00
IGL01759:Olfr523	APN	7	140176534	missense	probably benign	0.00
D3080:Olfr523	UTSW	7	140176362	missense	possibly damaging	0.94
R1644:Olfr523	UTSW	7	140176648	missense	probably benign	0.12
R1760:Olfr523	UTSW	7	140176275	missense	probably damaging	1.00
R1852:Olfr523	UTSW	7	140176561	nonsense	probably null
R1960:Olfr523	UTSW	7	140176683	missense	probably benign	0.37
R2363:Olfr523	UTSW	7	140176965	missense	probably damaging	1.00
R3700:Olfr523	UTSW	7	140176214	missense	possibly damaging	0.54
R4626:Olfr523	UTSW	7	140176446	missense	probably damaging	1.00
R4678:Olfr523	UTSW	7	140176228	missense	probably benign	0.21
R4779:Olfr523	UTSW	7	140176450	missense	probably damaging	1.00
R4999:Olfr523	UTSW	7	140177020	missense	probably damaging	1.00
R5663:Olfr523	UTSW	7	140176321	missense	probably damaging	1.00
R7352:Olfr523	UTSW	7	140176525	missense	probably damaging	1.00
R8525:Olfr523	UTSW	7	140176342	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGACCATTCATCTTGCTGGGCTTC -3'
(R):5'- GCACTATCCAGGGCGAAATGTCAC -3'

Sequencing Primer
(F):5'- TCTGCTTACAGTAGCTGGAAACC -3'
(R):5'- TCACAGAAGAAGTGGTTGATGAC -3'

Posted On

2013-06-12