Mutagenetix > Incidental Mutation

Incidental Mutation 'R4875:Myom1'

472560

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

044392-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4875 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71072119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 626 (V626A)

Ref Sequence

ENSEMBL: ENSMUSP00000136266 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

Predicted Effect

probably damaging
Transcript: ENSMUST00000024847
AA Change: V626A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V626A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073211
AA Change: V626A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V626A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179759
AA Change: V626A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V626A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Meta Mutation Damage Score

0.2324

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak1	A	T	2: 32,631,177	E119D	probably benign	Het
Alox5	A	T	6: 116,413,850		probably null	Het
Atad5	T	C	11: 80,120,689	V1294A	probably damaging	Het
BB019430	A	G	10: 58,704,043		noncoding transcript	Het
Bbs9	T	C	9: 22,578,715	F261L	probably benign	Het
Catsperb	A	T	12: 101,587,985	N646I	possibly damaging	Het
Ccdc112	A	G	18: 46,296,289	I114T	probably damaging	Het
Cecr2	T	C	6: 120,750,916	L340P	probably damaging	Het
Ces2e	T	A	8: 104,927,185	V85E	probably damaging	Het
Cnpy2	C	A	10: 128,326,095	T79K	probably damaging	Het
Cntn4	G	A	6: 106,437,913	R135H	possibly damaging	Het
Cpne8	T	A	15: 90,648,568		probably benign	Het
Ctso	C	T	3: 81,942,381		probably benign	Het
Cyp3a16	C	A	5: 145,452,849	M235I	probably benign	Het
Dll3	A	G	7: 28,296,435	C314R	probably damaging	Het
Dnah7c	A	G	1: 46,688,925	N2928D	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dqx1	C	A	6: 83,061,012	D460E	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ehbp1	A	G	11: 22,101,164	C438R	probably damaging	Het
Ehd3	T	G	17: 73,805,304	V21G	probably damaging	Het
Ero1lb	G	A	13: 12,604,436	V440I	probably damaging	Het
Fpgt	G	A	3: 155,087,913	A159V	probably damaging	Het
Gcn1l1	T	C	5: 115,576,170	L123P	possibly damaging	Het
Gm14496	A	T	2: 181,997,433	R439W	probably damaging	Het
Gm20767	T	C	13: 120,154,670	V15A	probably damaging	Het
Gm4353	G	C	7: 116,084,413	P49R	probably damaging	Het
Gsdmc2	C	T	15: 63,828,252	A224T	probably benign	Het
Helz	T	A	11: 107,637,734		probably benign	Het
Hnf1a	T	C	5: 114,970,673	T58A	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcns1	T	C	2: 164,168,101	Y246C	probably damaging	Het
Kif26b	A	G	1: 178,915,327	E549G	probably benign	Het
Krt9	T	C	11: 100,190,037	I330V	probably benign	Het
Lair1	A	T	7: 4,029,034	S25T	probably benign	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Luzp2	A	G	7: 55,167,248	I149V	possibly damaging	Het
Mcoln1	T	A	8: 3,507,422	S143T	probably benign	Het
Mcph1	A	G	8: 18,625,558		probably null	Het
Mgat5	G	A	1: 127,469,249	V578M	probably damaging	Het
Mis18bp1	G	A	12: 65,161,435	T168M	probably benign	Het
Mospd4	G	T	18: 46,465,737		noncoding transcript	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Nat6	C	T	9: 107,583,619	R238C	probably damaging	Het
Ncam1	T	C	9: 49,507,621		probably benign	Het
Ncor1	AGCTGCTGCTGCTGCTGCTGCTGCTG	AGCTGCTGCTGCTGCTGCTGCTG	11: 62,433,611		probably benign	Het
Ndufv1	T	C	19: 4,012,653		probably null	Het
Nlrp2	A	T	7: 5,298,859	F211L	probably benign	Het
Olfr1368	T	A	13: 21,142,280	Y259F	probably damaging	Het
Olfr1495	T	A	19: 13,768,762	M140K	probably damaging	Het
Olfr517	A	T	7: 108,868,786	F123I	probably damaging	Het
Osbpl11	G	A	16: 33,234,493	V649I	probably benign	Het
Pax8	T	A	2: 24,441,640	M144L	probably benign	Het
Pcnt	T	C	10: 76,369,854	T2555A	probably benign	Het
Plat	T	A	8: 22,768,450	I23K	probably benign	Het
Plpp2	G	A	10: 79,530,929	T51M	probably damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Prl7c1	T	C	13: 27,773,759	M233V	probably benign	Het
Prox1	A	C	1: 190,162,122	F42C	probably damaging	Het
Pwwp2b	A	T	7: 139,256,062	Q473L	possibly damaging	Het
Rims4	A	T	2: 163,865,523	N127K	probably null	Het
Scn1a	T	C	2: 66,328,476	T367A	possibly damaging	Het
Slc23a2	A	G	2: 132,056,880	I579T	possibly damaging	Het
Sp9	T	C	2: 73,273,618	V172A	possibly damaging	Het
Spta1	T	A	1: 174,175,830	L109Q	probably damaging	Het
Strap	ACCTGCCCTCCT	ACCT	6: 137,749,318		probably benign	Het
Synj2	A	T	17: 5,988,068		probably benign	Het
Tgif2-ps2	A	G	17: 40,115,383		noncoding transcript	Het
Tnrc18	A	T	5: 142,765,177	M1216K	unknown	Het
Tpst2	T	A	5: 112,309,821	Y69*	probably null	Het
Tpx2	C	A	2: 152,893,615	A721E	probably benign	Het
Trmt1l	A	G	1: 151,455,004	T591A	probably benign	Het
Tuba8	T	A	6: 121,226,083		probably benign	Het
Ubiad1	T	C	4: 148,444,099	T118A	possibly damaging	Het
Unc13c	T	C	9: 73,517,284	T2017A	probably damaging	Het
Vmn1r59	G	T	7: 5,454,109	N217K	probably benign	Het
Vmn2r87	T	C	10: 130,472,498	I624V	probably damaging	Het
Wdr4	A	G	17: 31,499,155	V315A	probably benign	Het
Xpo7	T	C	14: 70,676,816		probably null	Het
Zfp827	T	A	8: 79,060,774	W190R	probably damaging	Het
Zfp971	A	G	2: 178,033,147	T180A	probably benign	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

Posted On

2017-04-14