Incidental Mutation 'R0503:Gab1'
ID47258
Institutional Source Beutler Lab
Gene Symbol Gab1
Ensembl Gene ENSMUSG00000031714
Gene Namegrowth factor receptor bound protein 2-associated protein 1
Synonyms
MMRRC Submission 038698-MU
Accession Numbers

Genbank: NM_021356; MGI: 108088

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80764438-80880519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80800142 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 109 (R109H)
Ref Sequence ENSEMBL: ENSMUSP00000147784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034150] [ENSMUST00000210676]
Predicted Effect probably damaging
Transcript: ENSMUST00000034150
AA Change: R109H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034150
Gene: ENSMUSG00000031714
AA Change: R109H

DomainStartEndE-ValueType
PH 6 118 1.16e-23 SMART
low complexity region 336 354 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210676
AA Change: R109H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211018
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit developmental defects in the placenta, heart, eye, muscle, and skin, and die between embryonic day 13.5 and 18.5. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted, knock-out(1) Targeted, other(8) Gene trapped(34)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Gab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01679:Gab1 APN 8 80791549 missense probably benign 0.00
IGL02610:Gab1 APN 8 80800099 critical splice donor site probably null
IGL02661:Gab1 APN 8 80788937 missense probably damaging 1.00
IGL02716:Gab1 APN 8 80769694 missense probably damaging 1.00
D3080:Gab1 UTSW 8 80766378 missense probably damaging 1.00
R0006:Gab1 UTSW 8 80769730 missense possibly damaging 0.56
R0144:Gab1 UTSW 8 80785201 splice site probably benign
R0173:Gab1 UTSW 8 80800160 missense possibly damaging 0.68
R0414:Gab1 UTSW 8 80800289 missense probably damaging 1.00
R0675:Gab1 UTSW 8 80769668 missense probably damaging 1.00
R0690:Gab1 UTSW 8 80800116 missense probably damaging 1.00
R1068:Gab1 UTSW 8 80800172 missense possibly damaging 0.95
R1175:Gab1 UTSW 8 80784842 missense probably damaging 0.99
R1240:Gab1 UTSW 8 80788530 missense probably damaging 1.00
R1430:Gab1 UTSW 8 80788612 missense probably benign 0.34
R1656:Gab1 UTSW 8 80788759 missense probably damaging 1.00
R1986:Gab1 UTSW 8 80766381 missense probably damaging 1.00
R2860:Gab1 UTSW 8 80784753 missense probably benign 0.32
R2861:Gab1 UTSW 8 80784753 missense probably benign 0.32
R4683:Gab1 UTSW 8 80788632 missense probably benign 0.34
R4726:Gab1 UTSW 8 80789053 missense possibly damaging 0.80
R5425:Gab1 UTSW 8 80800389 missense probably damaging 1.00
R5684:Gab1 UTSW 8 80769670 missense probably damaging 1.00
R6195:Gab1 UTSW 8 80879532 nonsense probably null
R6217:Gab1 UTSW 8 80791608 missense possibly damaging 0.48
R6233:Gab1 UTSW 8 80879532 nonsense probably null
R6407:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6408:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6415:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6418:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6479:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R7019:Gab1 UTSW 8 80784817 missense probably damaging 0.99
R7291:Gab1 UTSW 8 80800151 missense probably damaging 1.00
R7432:Gab1 UTSW 8 80788669 missense probably benign 0.20
X0066:Gab1 UTSW 8 80879564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGCTCAAAATGTCAAATTCCG -3'
(R):5'- ACGATCATGCCAAGAAGCCTATTCG -3'

Sequencing Primer
(F):5'- agaacatctgtaacttcagtccc -3'
(R):5'- GCAAGTTGATGCTGGGTTGA -3'
Posted On2013-06-12