Incidental Mutation 'R0503:Katnb1'
ID47259
Institutional Source Beutler Lab
Gene Symbol Katnb1
Ensembl Gene ENSMUSG00000031787
Gene Namekatanin p80 (WD40-containing) subunit B 1
Synonyms2410003J24Rik, KAT
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0503 (G1)
Quality Score211
Status Validated
Chromosome8
Chromosomal Location95081186-95103149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95095174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 212 (T212A)
Ref Sequence ENSEMBL: ENSMUSP00000034239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968]
Predicted Effect probably damaging
Transcript: ENSMUST00000034239
AA Change: T212A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787
AA Change: T212A

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Meta Mutation Damage Score 0.5693 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit embryonic lethality, small embryo, brain and limb bud size, variable eye defects, holoprosencephaly, and thin cerebral cortex with fewer cortical progenitors and post-mitotic neurons. Mutant MEFs form multiple centrioles, multipolar spindles, and supernumerary primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Katnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Katnb1 APN 8 95098159 missense probably damaging 1.00
IGL02263:Katnb1 APN 8 95090075 missense probably damaging 1.00
IGL02896:Katnb1 APN 8 95096028 unclassified probably benign
H8562:Katnb1 UTSW 8 95095510 unclassified probably benign
R0139:Katnb1 UTSW 8 95098422 missense possibly damaging 0.90
R0418:Katnb1 UTSW 8 95095658 missense possibly damaging 0.92
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R1405:Katnb1 UTSW 8 95098173 missense probably damaging 1.00
R3960:Katnb1 UTSW 8 95087297 missense possibly damaging 0.48
R4866:Katnb1 UTSW 8 95097504 missense possibly damaging 0.78
R4930:Katnb1 UTSW 8 95097294 splice site probably null
R5160:Katnb1 UTSW 8 95095470 missense probably benign 0.01
R5184:Katnb1 UTSW 8 95097980 missense possibly damaging 0.80
R5333:Katnb1 UTSW 8 95095606 missense possibly damaging 0.95
R5529:Katnb1 UTSW 8 95097672 missense probably damaging 0.99
R5848:Katnb1 UTSW 8 95098712 missense probably benign 0.09
R6424:Katnb1 UTSW 8 95093516 missense probably damaging 1.00
R6478:Katnb1 UTSW 8 95095456 missense possibly damaging 0.57
R6785:Katnb1 UTSW 8 95095642 missense probably benign 0.04
R7009:Katnb1 UTSW 8 95098384 missense probably damaging 0.99
R7174:Katnb1 UTSW 8 95097441 missense probably benign 0.00
R7253:Katnb1 UTSW 8 95095497 nonsense probably null
R7486:Katnb1 UTSW 8 95098729 missense probably damaging 1.00
R7718:Katnb1 UTSW 8 95095208 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGTGTCCTGCTCTGTACTGACCTG -3'
(R):5'- TGGGAGAAAGCCACACCTATCTGC -3'

Sequencing Primer
(F):5'- GAGACCCCTGGCAATTGAG -3'
(R):5'- TTGCCCCAGTTGACAAGGAC -3'
Posted On2013-06-12