Mutagenetix > Incidental Mutation

Incidental Mutation 'R0503:Atp2c2'

47260

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

038698-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119734577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 279 (E279G)

Ref Sequence

ENSEMBL: ENSMUSP00000092794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]

AlphaFold

A7L9Z8

Predicted Effect

probably null
Transcript: ENSMUST00000095171
AA Change: E279G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: E279G

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212454

Meta Mutation Damage Score

0.5345

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (57/58)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,495	H755R	possibly damaging	Het
Ccdc65	G	T	15: 98,709,160	D83Y	probably damaging	Het
Cd200r2	T	A	16: 44,877,962	M1K	probably null	Het
Clca4c-ps	A	T	3: 144,879,822		noncoding transcript	Het
Col6a6	A	T	9: 105,767,351	M1246K	probably benign	Het
Comp	A	T	8: 70,375,734	N130I	possibly damaging	Het
Crot	A	G	5: 8,976,075	V304A	possibly damaging	Het
Dapk1	T	A	13: 60,730,848		probably null	Het
Dspp	A	T	5: 104,177,256	D495V	unknown	Het
Erich2	A	T	2: 70,509,699	R169S	probably damaging	Het
Erich2	C	A	2: 70,540,775	S426R	unknown	Het
Gab1	C	T	8: 80,800,142	R109H	probably damaging	Het
Ggcx	GTCTAT	GTCTATCTAT	6: 72,429,157		probably null	Het
Gria1	T	G	11: 57,189,716	V175G	probably damaging	Het
Hmcn1	C	T	1: 150,859,252	V170M	probably damaging	Het
Irx4	T	A	13: 73,266,584		probably null	Het
Katnb1	A	G	8: 95,095,174	T212A	probably damaging	Het
Kirrel	A	G	3: 87,097,802	S80P	probably benign	Het
Lrrc75b	T	C	10: 75,553,654	T81A	possibly damaging	Het
Macf1	A	G	4: 123,469,815	S1775P	probably damaging	Het
Mmp10	A	T	9: 7,507,339	I387F	probably damaging	Het
Mphosph10	A	T	7: 64,389,893	C110S	probably benign	Het
Mpig6b	A	G	17: 35,064,448		probably benign	Het
Mrps27	G	T	13: 99,409,795		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mybpc2	A	G	7: 44,512,570		probably benign	Het
Nbea	C	T	3: 55,642,836	G2724S	possibly damaging	Het
Nck2	A	G	1: 43,533,568	M1V	probably null	Het
Nefl	T	A	14: 68,083,983	D7E	probably benign	Het
Nktr	T	A	9: 121,750,740		probably benign	Het
Nlrp12	C	T	7: 3,249,377	E55K	probably damaging	Het
Nsun7	T	A	5: 66,283,581		probably benign	Het
Olfr1214	C	T	2: 88,987,978	V75I	probably benign	Het
Olfr523	T	C	7: 140,176,441	V113A	possibly damaging	Het
Olfr586	A	T	7: 103,122,436	M112K	possibly damaging	Het
Olfr729	T	A	14: 50,148,478	Y132F	probably damaging	Het
Olfr769	T	C	10: 129,111,802	T208A	probably damaging	Het
Olfr961	A	G	9: 39,647,476	Y250C	probably damaging	Het
Pcdh15	A	G	10: 74,210,385	T165A	probably damaging	Het
Pikfyve	A	T	1: 65,219,899	H410L	probably damaging	Het
Polr3c	A	T	3: 96,713,636		probably null	Het
Ptdss2	T	A	7: 141,151,797		probably benign	Het
Ptprg	A	G	14: 12,237,138	M1386V	possibly damaging	Het
Ptpru	T	C	4: 131,793,643	N784S	probably benign	Het
Rfx4	T	A	10: 84,894,332	I495K	possibly damaging	Het
Serpina12	C	A	12: 104,031,159	A368S	probably damaging	Het
Tmem39b	A	C	4: 129,686,986	Y238D	possibly damaging	Het
Tspan11	T	C	6: 127,939,112	W124R	probably benign	Het
Ttll10	T	C	4: 156,047,548		probably benign	Het
Tyro3	T	C	2: 119,803,230		probably benign	Het
Unc79	A	G	12: 103,078,868	M644V	probably benign	Het
Vmn1r196	G	A	13: 22,293,387	M65I	probably benign	Het
Vmn2r85	T	C	10: 130,422,740	Y482C	probably damaging	Het
Zfp940	A	G	7: 29,846,020		probably benign	Het
Zfyve9	A	T	4: 108,719,764	L40*	probably null	Het
Zkscan1	T	A	5: 138,093,326	I107N	probably damaging	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCCAGCTTCACAGGCGAAGTG -3'
(R):5'- GTATGATCCCAAATCCCGTGTCCTC -3'

Sequencing Primer
(F):5'- CCTGAGCAACGTGGTCTTC -3'
(R):5'- TCTGTAGGGGAGCAGGGC -3'

Posted On

2013-06-12