Incidental Mutation 'R0503:Mmp10'
ID47261
Institutional Source Beutler Lab
Gene Symbol Mmp10
Ensembl Gene ENSMUSG00000047562
Gene Namematrix metallopeptidase 10
Synonymsstromelysin 2
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7502352-7510240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7507339 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 387 (I387F)
Ref Sequence ENSEMBL: ENSMUSP00000034488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034488]
Predicted Effect probably damaging
Transcript: ENSMUST00000034488
AA Change: I387F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034488
Gene: ENSMUSG00000047562
AA Change: I387F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 27 87 3.2e-12 PFAM
ZnMc 105 265 1.81e-61 SMART
HX 295 337 2.03e-6 SMART
HX 339 382 9.11e-9 SMART
HX 387 434 8.49e-18 SMART
HX 436 476 3.88e-3 SMART
Meta Mutation Damage Score 0.7915 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. The lack of encoded protein in mice promotes experimental lung cancer formation, exacerbates experimental colitis and promotes development of inflammation-associated colonic dysplasia. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Mmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Mmp10 APN 9 7505650 missense possibly damaging 0.77
steel UTSW 9 7506512 missense probably benign 0.01
R0240:Mmp10 UTSW 9 7506543 missense probably damaging 1.00
R0240:Mmp10 UTSW 9 7506543 missense probably damaging 1.00
R0595:Mmp10 UTSW 9 7508198 missense probably benign
R1222:Mmp10 UTSW 9 7505681 splice site probably benign
R1487:Mmp10 UTSW 9 7509977 missense probably damaging 0.98
R1622:Mmp10 UTSW 9 7504995 nonsense probably null
R1669:Mmp10 UTSW 9 7505525 critical splice acceptor site probably null
R1806:Mmp10 UTSW 9 7506501 missense probably benign 0.01
R1880:Mmp10 UTSW 9 7505574 missense probably benign 0.00
R4749:Mmp10 UTSW 9 7508168 missense probably damaging 1.00
R4866:Mmp10 UTSW 9 7508189 missense probably damaging 1.00
R5231:Mmp10 UTSW 9 7502500 critical splice donor site probably null
R5367:Mmp10 UTSW 9 7505602 missense probably damaging 1.00
R5814:Mmp10 UTSW 9 7503620 missense possibly damaging 0.91
R6131:Mmp10 UTSW 9 7503632 splice site probably null
R6542:Mmp10 UTSW 9 7506512 missense probably benign 0.01
R6997:Mmp10 UTSW 9 7503530 missense probably benign 0.08
R7400:Mmp10 UTSW 9 7503300 missense probably damaging 1.00
R7513:Mmp10 UTSW 9 7508127 missense probably damaging 1.00
R7593:Mmp10 UTSW 9 7503153 missense probably damaging 1.00
R7676:Mmp10 UTSW 9 7503549 missense probably damaging 1.00
R7830:Mmp10 UTSW 9 7507283 missense probably benign 0.00
Z1176:Mmp10 UTSW 9 7508205 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- TGACTACAGTTGGCTACGATAACCCAT -3'
(R):5'- GTCAAGTTGAACCTCCACATCGTCTTT -3'

Sequencing Primer
(F):5'- acctgcctctgactccc -3'
(R):5'- CCACATCGTCTTTTGCTTAATCAG -3'
Posted On2013-06-12