Incidental Mutation 'R4892:Stk17b'
ID 472622
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4892 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 53755506-53785224 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53771611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 112 (Y112N)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect probably damaging
Transcript: ENSMUST00000027263
AA Change: Y112N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: Y112N

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fmo3 T A 1: 162,968,731 I91F probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53764140 missense probably damaging 0.99
IGL00767:Stk17b APN 1 53764023 splice site probably benign
IGL01012:Stk17b APN 1 53761037 missense probably benign 0.06
IGL01431:Stk17b APN 1 53765915 splice site probably benign
IGL01914:Stk17b APN 1 53761067 missense probably damaging 0.98
IGL02236:Stk17b APN 1 53764088 missense probably damaging 1.00
IGL02827:Stk17b APN 1 53776542 missense probably benign 0.03
R0013:Stk17b UTSW 1 53764132 missense probably benign 0.36
R0545:Stk17b UTSW 1 53762583 splice site probably benign
R0831:Stk17b UTSW 1 53757492 missense probably damaging 1.00
R1035:Stk17b UTSW 1 53762599 missense probably benign 0.22
R1375:Stk17b UTSW 1 53765947 missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53757590 missense probably damaging 1.00
R1809:Stk17b UTSW 1 53765981 missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53761082 missense probably damaging 1.00
R2033:Stk17b UTSW 1 53761076 missense probably damaging 1.00
R2105:Stk17b UTSW 1 53776605 missense probably benign 0.01
R2255:Stk17b UTSW 1 53776572 missense probably benign 0.00
R4395:Stk17b UTSW 1 53764115 missense probably damaging 0.98
R4521:Stk17b UTSW 1 53764038 missense probably damaging 1.00
R4777:Stk17b UTSW 1 53771708 missense probably damaging 1.00
R4871:Stk17b UTSW 1 53757534 missense probably benign 0.14
R4999:Stk17b UTSW 1 53761147 splice site probably null
R5122:Stk17b UTSW 1 53776558 missense probably damaging 1.00
R5621:Stk17b UTSW 1 53771784 nonsense probably null
R6636:Stk17b UTSW 1 53761088 missense probably damaging 1.00
R6924:Stk17b UTSW 1 53761059 missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53757515 missense probably benign
R7322:Stk17b UTSW 1 53765945 missense probably benign 0.16
R7671:Stk17b UTSW 1 53766000 missense probably damaging 0.99
R8984:Stk17b UTSW 1 53757625 missense probably benign 0.05
R9476:Stk17b UTSW 1 53757739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTGCTGTAAATGAATTTTGGC -3'
(R):5'- GAGGAAAATTTGCTGTGGTTAGAC -3'

Sequencing Primer
(F):5'- GCTGTAAATGAATTTTGGCCTAGATG -3'
(R):5'- TTGCTGTGGTTAGACAATGTATATC -3'
Posted On 2017-04-14