Incidental Mutation 'R4825:Sdk1'
ID472640
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 042441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4825 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 141582294 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 82 (D82E)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: D82E

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: D82E

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C A 11: 109,791,672 L229F probably benign Het
A930002H24Rik A C 17: 63,863,608 S62A unknown Het
Abca12 T A 1: 71,302,685 Q1039L possibly damaging Het
Adgrg5 T A 8: 94,941,734 F476I possibly damaging Het
AI314180 G A 4: 58,850,911 L421F probably damaging Het
Alms1 A G 6: 85,678,245 K2789E probably damaging Het
Arrdc2 G A 8: 70,839,277 probably null Het
Atp2b1 T A 10: 99,009,564 I743K probably damaging Het
Atp6v1c2 C T 12: 17,289,060 G230D probably benign Het
AU040320 G A 4: 126,791,793 C54Y probably damaging Het
BC024139 C T 15: 76,120,317 V680I possibly damaging Het
Bckdhb A G 9: 83,988,905 D156G probably damaging Het
Canx T A 11: 50,308,809 D143V probably benign Het
Ccdc180 T A 4: 45,912,794 V591E possibly damaging Het
Ccno T C 13: 112,988,099 S68P probably benign Het
Cdc45 C T 16: 18,784,863 E527K probably damaging Het
Cep290 T A 10: 100,488,348 D14E probably damaging Het
Cgnl1 A G 9: 71,630,524 V1238A probably benign Het
Ciz1 C T 2: 32,371,741 A455V probably damaging Het
Coro2b T A 9: 62,454,623 Y86F probably benign Het
Csf2ra C T 19: 61,226,552 R158Q probably benign Het
Cubn A T 2: 13,325,225 I2615N probably damaging Het
Dhx8 C T 11: 101,738,170 R129* probably null Het
Disc1 T A 8: 125,135,302 M471K possibly damaging Het
Dmxl2 G T 9: 54,404,041 L1799I probably benign Het
Dnah2 A G 11: 69,423,205 S4108P probably damaging Het
Ehmt2 C G 17: 34,906,964 P211R probably benign Het
Eif4g3 A G 4: 138,194,081 D1557G probably benign Het
Epha5 T C 5: 84,233,840 D384G probably damaging Het
Etl4 A G 2: 20,806,927 I1274V probably damaging Het
Fam160a1 G A 3: 85,673,432 P489S possibly damaging Het
Fip1l1 G A 5: 74,588,205 probably null Het
Fubp1 T C 3: 152,217,890 probably null Het
Glul T C 1: 153,903,044 V33A probably benign Het
Gm4846 A G 1: 166,491,668 F167S probably damaging Het
Heatr6 T A 11: 83,758,322 L168M probably damaging Het
Hif1a T A 12: 73,932,401 I233N probably damaging Het
Hivep2 T A 10: 14,131,319 H1220Q possibly damaging Het
Igkv8-21 T C 6: 70,315,426 I9M probably benign Het
Izumo1 T A 7: 45,624,987 C62* probably null Het
Jakmip3 G A 7: 139,026,766 E424K probably damaging Het
Klhl2 A G 8: 64,752,813 V358A probably damaging Het
Klk10 C G 7: 43,783,598 D139E probably damaging Het
Klk14 T C 7: 43,692,076 C51R probably damaging Het
Klk5 T G 7: 43,845,390 I99S probably damaging Het
L3hypdh T C 12: 72,077,393 T258A probably benign Het
Lrp5 A G 19: 3,614,292 Y812H probably damaging Het
Lrrc40 T A 3: 158,061,330 L474* probably null Het
Mkks A T 2: 136,880,655 M194K probably benign Het
Mmp20 A G 9: 7,654,120 D347G probably damaging Het
Mmp27 A G 9: 7,581,194 E460G probably damaging Het
Mms22l T C 4: 24,536,226 F605S probably damaging Het
Mpzl3 A G 9: 45,068,329 S193G probably benign Het
Muc4 A T 16: 32,751,747 T542S probably benign Het
Muc5b T C 7: 141,868,465 L4446P possibly damaging Het
Mxi1 C A 19: 53,370,338 S131* probably null Het
Nanog G T 6: 122,713,340 A210S probably benign Het
Nrcam C T 12: 44,575,986 Q988* probably null Het
Nsg1 C A 5: 38,159,047 probably benign Het
Ogfod3 G A 11: 121,195,201 A189V probably benign Het
Olfr1121 T A 2: 87,372,088 C185* probably null Het
Olfr1228 T C 2: 89,248,690 probably null Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G A 2: 89,978,153 C125Y probably damaging Het
Olfr1465 A T 19: 13,314,320 probably null Het
Olfr548-ps1 T A 7: 102,542,380 V148E possibly damaging Het
Olfr58 T G 9: 19,783,576 S148A possibly damaging Het
Olfr632 T C 7: 103,937,503 V41A probably benign Het
Olfr920 A T 9: 38,756,407 T240S probably damaging Het
Olfr980 A T 9: 40,006,742 M69K possibly damaging Het
Orc3 A T 4: 34,571,774 M665K possibly damaging Het
Pabpc1 A G 15: 36,597,011 S591P probably damaging Het
Parp6 T A 9: 59,624,362 probably null Het
Pcdh1 T C 18: 38,189,859 M974V possibly damaging Het
Pcdhb22 T A 18: 37,520,660 V727E possibly damaging Het
Pex5l T C 3: 32,992,985 E272G probably damaging Het
Pglyrp2 G T 17: 32,418,261 N264K probably benign Het
Phxr4 T A 9: 13,431,586 probably benign Het
Piezo2 A G 18: 63,144,954 F293S probably damaging Het
Pkhd1 T C 1: 20,537,401 D1077G probably damaging Het
Plekhs1 A G 19: 56,473,268 probably null Het
Prex1 G T 2: 166,585,857 C788* probably null Het
Prrt3 A T 6: 113,498,138 M41K probably benign Het
Ptgir T C 7: 16,908,843 V326A probably damaging Het
Ptprg T A 14: 12,220,654 D455E probably damaging Het
Ptpru T A 4: 131,799,603 Q686L probably benign Het
Pxdc1 G T 13: 34,630,360 T190K probably benign Het
Rap1b A T 10: 117,818,582 C118S probably benign Het
Rapgef2 T C 3: 79,083,227 M915V probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpe65 C T 3: 159,624,681 A495V probably benign Het
Samd15 A G 12: 87,200,834 T98A possibly damaging Het
Slc26a7 T C 4: 14,546,309 D340G probably benign Het
Slc6a15 T A 10: 103,418,060 M619K probably benign Het
Slc7a4 C A 16: 17,574,521 D350Y probably damaging Het
Slk T G 19: 47,619,956 N449K probably benign Het
Spta1 A T 1: 174,244,042 probably null Het
Sptbn5 A T 2: 120,055,893 probably benign Het
Srd5a2 A T 17: 74,047,805 V8D probably benign Het
Srgap3 G A 6: 112,727,310 A906V probably benign Het
Stab2 A T 10: 86,947,147 M679K probably benign Het
Stk3 T C 15: 34,999,908 I291V probably benign Het
Supt6 T A 11: 78,208,134 Q1637L possibly damaging Het
Svil T C 18: 5,114,564 F2047S probably damaging Het
Swsap1 A G 9: 21,955,988 E76G probably benign Het
Syndig1 G T 2: 149,899,553 G20C probably damaging Het
Synj2bp A T 12: 81,502,152 N104K probably damaging Het
Synpo2 T A 3: 123,114,419 D416V probably damaging Het
Tacc3 G T 5: 33,672,013 C620F probably damaging Het
Tanc1 A G 2: 59,699,422 E19G probably damaging Het
Tarsl2 C T 7: 65,647,554 A139V probably benign Het
Tbc1d22a T A 15: 86,351,734 C365S probably damaging Het
Tdpoz2 T C 3: 93,652,074 H197R possibly damaging Het
Tha1 A T 11: 117,869,379 N300K probably damaging Het
Tm6sf1 T A 7: 81,865,260 F70L probably damaging Het
Tmem132b T A 5: 125,783,433 S581T probably benign Het
Tmem206 A T 1: 191,340,843 I154F probably damaging Het
Tnfsf13 G T 11: 69,685,249 S4* probably null Het
Tonsl G A 15: 76,633,248 S757L probably benign Het
Trem2 G T 17: 48,351,691 R161S possibly damaging Het
Trpm2 A T 10: 77,941,173 V430E probably damaging Het
Ttc14 T A 3: 33,801,369 D154E possibly damaging Het
Ugt2b37 T C 5: 87,250,639 M313V possibly damaging Het
Uhrf1bp1 G A 17: 27,877,394 A107T probably damaging Het
Vmn2r24 A G 6: 123,815,780 I689V probably benign Het
Wdr76 A G 2: 121,542,494 T601A probably benign Het
Xirp1 T C 9: 120,017,003 D938G possibly damaging Het
Zfp608 A T 18: 54,897,969 D966E probably benign Het
Zfp957 A G 14: 79,214,356 M1T probably null Het
Zkscan16 A T 4: 58,957,809 H697L possibly damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense not run
Z1177:Sdk1 UTSW 5 141962708 missense not run
Predicted Primers PCR Primer
(F):5'- GAATTATTTGCTACTTCACTGGGC -3'
(R):5'- TGTCACCAGGTCCTACAAGG -3'

Sequencing Primer
(F):5'- GCTACTTCACTGGGCTACATAG -3'
(R):5'- AGGGGTTCAGCTATAACCTCG -3'
Posted On2017-04-14