Incidental Mutation 'R4860:Ppfibp1'
ID472663
Institutional Source Beutler Lab
Gene Symbol Ppfibp1
Ensembl Gene ENSMUSG00000016487
Gene NamePTPRF interacting protein, binding protein 1 (liprin beta 1)
Synonyms
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R4860 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146888487-147032025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146990514 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000144887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000111623] [ENSMUST00000154221] [ENSMUST00000204660]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
AA Change: T91A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111623
AA Change: T91A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154221
SMART Domains Protein: ENSMUSP00000122515
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
coiled coil region 7 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204660
AA Change: T91A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144887
Gene: ENSMUSG00000016487
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
coiled coil region 99 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205056
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein was found to interact with S100A4, a calcium-binding protein related to tumor invasiveness and metastasis. In vitro experiment demonstrated that the interaction inhibited the phosphorylation of this protein by protein kinase C and protein kinase CK2. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Ctsh A G 9: 90,054,548 E26G probably benign Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Muc4 G A 16: 32,754,616 G1497R probably benign Het
Muc4 T A 16: 32,754,625 S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Ppfibp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ppfibp1 APN 6 147029697 missense probably benign 0.07
IGL02644:Ppfibp1 APN 6 147022440 missense probably damaging 1.00
IGL02711:Ppfibp1 APN 6 147026238 nonsense probably null
IGL02737:Ppfibp1 APN 6 147027308 missense probably damaging 1.00
IGL02745:Ppfibp1 APN 6 147022354 unclassified probably benign
IGL03120:Ppfibp1 APN 6 146998169 missense probably benign 0.00
IGL03300:Ppfibp1 APN 6 147030327 missense probably damaging 1.00
R0114:Ppfibp1 UTSW 6 146998233 missense probably benign 0.04
R0480:Ppfibp1 UTSW 6 147019031 splice site probably null
R0699:Ppfibp1 UTSW 6 147026222 missense probably damaging 0.99
R1515:Ppfibp1 UTSW 6 147027432 missense probably benign
R1830:Ppfibp1 UTSW 6 147022259 critical splice donor site probably null
R1858:Ppfibp1 UTSW 6 146990592 missense probably benign 0.06
R2160:Ppfibp1 UTSW 6 147027453 missense probably damaging 0.98
R2389:Ppfibp1 UTSW 6 147022171 missense probably damaging 1.00
R2517:Ppfibp1 UTSW 6 146992444 missense probably damaging 1.00
R3882:Ppfibp1 UTSW 6 146998221 missense possibly damaging 0.67
R4035:Ppfibp1 UTSW 6 146996836 missense probably damaging 0.99
R4202:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4205:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4420:Ppfibp1 UTSW 6 147026238 nonsense probably null
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4974:Ppfibp1 UTSW 6 147030419 utr 3 prime probably benign
R5163:Ppfibp1 UTSW 6 147022131 splice site probably null
R5180:Ppfibp1 UTSW 6 147027321 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 146996840 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 147016330 missense probably damaging 1.00
R5458:Ppfibp1 UTSW 6 147012435 intron probably benign
R5479:Ppfibp1 UTSW 6 147030150 critical splice donor site probably null
R5631:Ppfibp1 UTSW 6 146996860 missense probably damaging 1.00
R6277:Ppfibp1 UTSW 6 147005924 missense probably benign 0.01
R6577:Ppfibp1 UTSW 6 146999655 splice site probably null
R6602:Ppfibp1 UTSW 6 146978221 missense possibly damaging 0.62
R7320:Ppfibp1 UTSW 6 146978053 missense probably damaging 1.00
R7440:Ppfibp1 UTSW 6 147019503 missense probably benign 0.01
R7455:Ppfibp1 UTSW 6 147016350 missense probably damaging 1.00
R7710:Ppfibp1 UTSW 6 146996405 missense probably benign 0.00
R8379:Ppfibp1 UTSW 6 147030345 missense probably damaging 1.00
R8439:Ppfibp1 UTSW 6 147000950 missense possibly damaging 0.94
R8692:Ppfibp1 UTSW 6 146990515 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCAAGACAGGGTACTTGTTTTC -3'
(R):5'- GTGCTTAATACAGGTGTTGCAC -3'

Sequencing Primer
(F):5'- CTGTTTACTCAGAAATGGGGTAAGTC -3'
(R):5'- CATATATGTGATTCAAAGTTGCAAGG -3'
Posted On2017-04-14