Incidental Mutation 'R4860:Slmap'
ID 472665
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Name sarcolemma associated protein
Synonyms Slap, D330001L02Rik, Miranda
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4860 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 26134323-26256086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26181364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 323 (V323E)
Ref Sequence ENSEMBL: ENSMUSP00000117816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
AlphaFold Q3URD3
Predicted Effect probably benign
Transcript: ENSMUST00000038522
AA Change: V323E

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: V323E

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090359
AA Change: V323E

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870
AA Change: V323E

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102956
AA Change: V323E

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: V323E

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112330
AA Change: V323E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870
AA Change: V323E

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112331
AA Change: V202E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870
AA Change: V202E

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139075
AA Change: V323E

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: V323E

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142679
SMART Domains Protein: ENSMUSP00000123072
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 52 N/A INTRINSIC
coiled coil region 97 179 N/A INTRINSIC
coiled coil region 206 405 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144737
Predicted Effect probably benign
Transcript: ENSMUST00000145738
SMART Domains Protein: ENSMUSP00000117276
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 59 N/A INTRINSIC
coiled coil region 138 220 N/A INTRINSIC
coiled coil region 247 447 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146438
AA Change: V86E
SMART Domains Protein: ENSMUSP00000123344
Gene: ENSMUSG00000021870
AA Change: V86E

DomainStartEndE-ValueType
coiled coil region 17 142 N/A INTRINSIC
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Ctsh A G 9: 89,936,601 (GRCm39) E26G probably benign Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26,184,865 (GRCm39) missense probably damaging 0.97
IGL02612:Slmap APN 14 26,180,621 (GRCm39) splice site probably benign
IGL02630:Slmap APN 14 26,143,586 (GRCm39) missense possibly damaging 0.93
IGL02798:Slmap APN 14 26,191,533 (GRCm39) missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26,254,586 (GRCm39) missense probably damaging 1.00
R0433:Slmap UTSW 14 26,174,749 (GRCm39) nonsense probably null
R0963:Slmap UTSW 14 26,189,675 (GRCm39) missense probably damaging 1.00
R1721:Slmap UTSW 14 26,181,373 (GRCm39) splice site probably benign
R1848:Slmap UTSW 14 26,143,729 (GRCm39) missense probably benign
R2151:Slmap UTSW 14 26,139,402 (GRCm39) missense probably damaging 1.00
R2152:Slmap UTSW 14 26,139,402 (GRCm39) missense probably damaging 1.00
R2153:Slmap UTSW 14 26,139,402 (GRCm39) missense probably damaging 1.00
R2154:Slmap UTSW 14 26,139,402 (GRCm39) missense probably damaging 1.00
R3725:Slmap UTSW 14 26,148,397 (GRCm39) missense probably damaging 0.99
R3726:Slmap UTSW 14 26,148,397 (GRCm39) missense probably damaging 0.99
R3935:Slmap UTSW 14 26,180,570 (GRCm39) missense probably benign
R4118:Slmap UTSW 14 26,204,027 (GRCm39) missense probably damaging 0.99
R4594:Slmap UTSW 14 26,186,772 (GRCm39) missense probably damaging 1.00
R4731:Slmap UTSW 14 26,189,690 (GRCm39) missense probably damaging 0.97
R4732:Slmap UTSW 14 26,189,690 (GRCm39) missense probably damaging 0.97
R4733:Slmap UTSW 14 26,189,690 (GRCm39) missense probably damaging 0.97
R4817:Slmap UTSW 14 26,183,507 (GRCm39) missense probably damaging 0.97
R4847:Slmap UTSW 14 26,147,763 (GRCm39) missense possibly damaging 0.90
R4860:Slmap UTSW 14 26,181,364 (GRCm39) missense probably benign 0.22
R5092:Slmap UTSW 14 26,184,744 (GRCm39) missense probably damaging 1.00
R5211:Slmap UTSW 14 26,204,117 (GRCm39) missense probably damaging 1.00
R5387:Slmap UTSW 14 26,181,088 (GRCm39) missense probably benign 0.22
R5821:Slmap UTSW 14 26,183,435 (GRCm39) missense probably damaging 1.00
R6404:Slmap UTSW 14 26,143,566 (GRCm39) splice site probably null
R6856:Slmap UTSW 14 26,151,247 (GRCm39) splice site probably null
R6977:Slmap UTSW 14 26,254,574 (GRCm39) missense probably damaging 1.00
R7108:Slmap UTSW 14 26,143,676 (GRCm39) missense probably benign 0.04
R7320:Slmap UTSW 14 26,181,227 (GRCm39) missense possibly damaging 0.53
R7470:Slmap UTSW 14 26,148,575 (GRCm39) missense probably benign
R7520:Slmap UTSW 14 26,148,575 (GRCm39) missense probably benign
R7540:Slmap UTSW 14 26,181,346 (GRCm39) missense probably damaging 0.99
R7544:Slmap UTSW 14 26,151,003 (GRCm39) missense probably damaging 0.99
R7544:Slmap UTSW 14 26,151,001 (GRCm39) missense probably damaging 0.99
R8112:Slmap UTSW 14 26,143,703 (GRCm39) missense probably damaging 1.00
R8153:Slmap UTSW 14 26,254,488 (GRCm39) missense probably benign
R8196:Slmap UTSW 14 26,189,646 (GRCm39) missense probably damaging 1.00
R8300:Slmap UTSW 14 26,139,374 (GRCm39) missense possibly damaging 0.62
R8523:Slmap UTSW 14 26,150,965 (GRCm39) missense probably damaging 0.99
R9039:Slmap UTSW 14 26,254,519 (GRCm39) missense probably benign 0.08
R9094:Slmap UTSW 14 26,137,355 (GRCm39) intron probably benign
R9504:Slmap UTSW 14 26,136,133 (GRCm39) missense probably damaging 1.00
R9657:Slmap UTSW 14 26,151,013 (GRCm39) missense probably benign 0.19
R9695:Slmap UTSW 14 26,183,496 (GRCm39) missense probably damaging 0.97
R9763:Slmap UTSW 14 26,204,118 (GRCm39) missense probably damaging 1.00
R9801:Slmap UTSW 14 26,143,595 (GRCm39) missense probably damaging 1.00
Z1177:Slmap UTSW 14 26,254,605 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCAGGTGTTCTAACCG -3'
(R):5'- CGGTGCAGATCACTCACTTTC -3'

Sequencing Primer
(F):5'- CTGCAGGTGTTCTAACCGTACTG -3'
(R):5'- GCAGATCACTCACTTTCCACATTGAG -3'
Posted On 2017-04-14