Mutagenetix > Incidental Mutation

Incidental Mutation 'R4790:Sspo'

472698

Institutional Source

Beutler Lab

Gene Symbol

Sspo

Ensembl Gene

ENSMUSG00000029797

Gene Name

SCO-spondin

Synonyms

C79529, Scospondin

MMRRC Submission

042418-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4790 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48425163-48478184 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48437705 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1413 (G1413D)

Ref Sequence

ENSEMBL: ENSMUSP00000131401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043676
AA Change: G1288D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: G1288D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
Pfam:VWD	154	219	7.4e-11	PFAM
C8	267	346	2.3e-10	SMART
Pfam:TIL	349	404	3.2e-13	PFAM
VWC	406	448	2e-1	SMART
VWD	433	593	5.08e-29	SMART
C8	631	703	2.14e-28	SMART
Pfam:TIL	706	759	5.8e-11	PFAM
VWC	856	924	4.76e-2	SMART
VWD	883	1042	9.59e-48	SMART
C8	1076	1150	3.62e-26	SMART
Pfam:TIL	1153	1209	2.6e-13	PFAM
LDLa	1253	1291	2.29e-13	SMART
LDLa	1293	1328	1.87e-9	SMART
LDLa	1329	1366	5.77e-10	SMART
LDLa	1369	1408	1.52e-9	SMART
LDLa	1442	1479	2.55e-11	SMART
LDLa	1480	1520	5.6e-8	SMART
LDLa	1533	1574	2.29e-4	SMART
TSP1	1575	1626	6.47e-13	SMART
TSP1	1631	1686	1.35e-10	SMART
Pfam:TIL	1690	1746	3.1e-9	PFAM
TSP1	1774	1827	6.94e-2	SMART
VWC	1829	1886	4.95e-9	SMART
low complexity region	1901	1911	N/A	INTRINSIC
FA58C	1928	2085	1.4e-2	SMART
LDLa	2091	2128	1.48e-7	SMART
LDLa	2242	2279	5.68e-9	SMART
LDLa	2299	2336	5.77e-10	SMART
TSP1	2339	2389	1.42e-9	SMART
TSP1	2394	2446	6.36e-21	SMART
Pfam:TIL	2460	2511	5.7e-10	PFAM
VWC	2513	2567	2.48e-1	SMART
TSP1	2554	2605	3.07e-14	SMART
TSP1	2611	2664	4.05e-5	SMART
TSP1	2669	2719	1.83e-12	SMART
EGF_like	2733	2776	5.45e1	SMART
VWC	2783	2836	2.73e-11	SMART
TSP1	2823	2875	3.72e-13	SMART
TSP1	2878	2919	6.05e-4	SMART
Pfam:TIL	2926	2978	1.1e-11	PFAM
VWC	2980	3035	9.77e-2	SMART
TSP1	3022	3086	6.68e-6	SMART
TSP1	3091	3143	1.08e-14	SMART
Pfam:TIL	3147	3201	2.2e-9	PFAM
VWC	3203	3260	2.72e-1	SMART
TSP1	3247	3306	3.72e-4	SMART
TSP1	3311	3363	5.27e-4	SMART
Pfam:TIL	3365	3421	4.2e-9	PFAM
TSP1	3484	3529	1.87e-9	SMART
low complexity region	3591	3601	N/A	INTRINSIC
TSP1	3660	3713	5.02e-10	SMART
TSP1	3730	3779	2.95e-7	SMART
TSP1	3796	3849	1.99e-13	SMART
TSP1	3854	3906	2.51e-10	SMART
Pfam:TIL	3909	3964	3.4e-11	PFAM
VWC	3966	4022	1.26e0	SMART
TSP1	4009	4059	4.05e-5	SMART
TSP1	4103	4155	3.19e-12	SMART
TSP1	4161	4213	2.87e-2	SMART
TSP1	4218	4269	1.45e-6	SMART
Pfam:TIL	4273	4328	2.1e-10	PFAM
TSP1	4468	4516	7.56e-5	SMART
low complexity region	4551	4562	N/A	INTRINSIC
VWC	4578	4652	5.21e-1	SMART
TSP1	4619	4669	3.92e-12	SMART
Pfam:TIL	4671	4725	1.5e-11	PFAM
Pfam:TIL	4777	4835	3.1e-9	PFAM
VWC	4837	4892	1.8e-11	SMART
GHB	4904	4997	1.02e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169350
AA Change: G1413D

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: G1413D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
VWD	185	341	4.36e-28	SMART
C8	390	469	2.3e-10	SMART
Pfam:TIL	472	527	8.6e-13	PFAM
VWC	529	571	2e-1	SMART
VWD	556	716	5.08e-29	SMART
C8	754	826	2.14e-28	SMART
Pfam:TIL	829	882	1.6e-10	PFAM
VWC	979	1047	4.76e-2	SMART
VWD	1006	1165	9.59e-48	SMART
C8	1201	1275	3.62e-26	SMART
Pfam:TIL	1278	1334	7e-13	PFAM
LDLa	1378	1416	2.29e-13	SMART
LDLa	1418	1453	1.87e-9	SMART
LDLa	1454	1491	5.77e-10	SMART
LDLa	1494	1533	1.52e-9	SMART
LDLa	1567	1604	2.55e-11	SMART
LDLa	1605	1645	5.6e-8	SMART
LDLa	1658	1699	2.29e-4	SMART
TSP1	1700	1751	6.47e-13	SMART
TSP1	1756	1811	1.35e-10	SMART
Pfam:TIL	1815	1871	8.3e-9	PFAM
VWC	1873	1928	2.42e-1	SMART
TSP1	1915	1968	6.94e-2	SMART
VWC	1970	2027	4.95e-9	SMART
low complexity region	2042	2052	N/A	INTRINSIC
FA58C	2069	2226	1.4e-2	SMART
LDLa	2232	2269	1.48e-7	SMART
LDLa	2387	2424	5.68e-9	SMART
LDLa	2444	2481	5.77e-10	SMART
TSP1	2484	2534	1.42e-9	SMART
TSP1	2539	2591	6.36e-21	SMART
Pfam:TIL	2606	2656	1.8e-9	PFAM
VWC	2658	2712	2.48e-1	SMART
TSP1	2699	2750	3.07e-14	SMART
TSP1	2756	2809	4.05e-5	SMART
TSP1	2814	2864	1.83e-12	SMART
EGF_like	2878	2921	5.45e1	SMART
VWC	2928	2981	2.73e-11	SMART
TSP1	2968	3020	3.72e-13	SMART
TSP1	3023	3064	6.05e-4	SMART
Pfam:TIL	3071	3123	3e-11	PFAM
VWC	3125	3180	9.77e-2	SMART
TSP1	3167	3231	6.68e-6	SMART
TSP1	3236	3288	1.08e-14	SMART
Pfam:TIL	3292	3346	6e-9	PFAM
VWC	3348	3405	2.72e-1	SMART
TSP1	3392	3451	3.72e-4	SMART
TSP1	3456	3508	5.27e-4	SMART
Pfam:TIL	3510	3566	1.1e-8	PFAM
TSP1	3629	3674	1.87e-9	SMART
low complexity region	3734	3744	N/A	INTRINSIC
TSP1	3803	3856	5.02e-10	SMART
TSP1	3873	3922	2.95e-7	SMART
TSP1	3939	3992	1.99e-13	SMART
TSP1	3997	4049	2.51e-10	SMART
Pfam:TIL	4052	4107	9.1e-11	PFAM
VWC	4109	4165	1.26e0	SMART
TSP1	4152	4202	4.05e-5	SMART
TSP1	4246	4298	3.19e-12	SMART
TSP1	4304	4356	2.87e-2	SMART
TSP1	4361	4412	1.45e-6	SMART
Pfam:TIL	4416	4471	5.6e-10	PFAM
TSP1	4611	4659	7.56e-5	SMART
low complexity region	4694	4705	N/A	INTRINSIC
VWC	4721	4795	5.21e-1	SMART
TSP1	4762	4812	3.92e-12	SMART
Pfam:TIL	4814	4868	4e-11	PFAM
Pfam:TIL	4920	4978	8.4e-9	PFAM
VWC	4980	5035	1.8e-11	SMART
GHB	5050	5143	1.02e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212740
AA Change: G1413D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	G	11: 110,202,236 (GRCm39)	T390P	possibly damaging	Het
Acss3	A	T	10: 106,859,563 (GRCm39)	Y345*	probably null	Het
Adam26b	A	T	8: 43,973,764 (GRCm39)	S413T	probably benign	Het
Angpt2	T	A	8: 18,764,098 (GRCm39)	Q148L	probably damaging	Het
Ank3	T	A	10: 69,823,981 (GRCm39)	Y883*	probably null	Het
Ankrd52	A	G	10: 128,216,814 (GRCm39)	K190E	possibly damaging	Het
Anks1b	A	G	10: 89,999,137 (GRCm39)	R415G	probably damaging	Het
Ano3	T	A	2: 110,715,264 (GRCm39)	Q58L	probably benign	Het
Aoc1l2	T	A	6: 48,907,486 (GRCm39)	I162N	probably damaging	Het
Arhgap39	A	T	15: 76,610,931 (GRCm39)	M924K	possibly damaging	Het
AU040320	A	G	4: 126,741,008 (GRCm39)	M910V	possibly damaging	Het
BC051019	T	A	7: 109,315,553 (GRCm39)	H86L	probably benign	Het
C1qbp	G	A	11: 70,870,856 (GRCm39)	Q151*	probably null	Het
C4b	G	T	17: 34,953,117 (GRCm39)	D1069E	probably benign	Het
Casp1	C	T	9: 5,303,020 (GRCm39)	T158I	probably benign	Het
Casq1	T	C	1: 172,044,404 (GRCm39)	D141G	probably damaging	Het
Ccdc33	T	A	9: 57,937,240 (GRCm39)	E653V	probably damaging	Het
Cd180	C	T	13: 102,839,330 (GRCm39)	T71M	probably damaging	Het
Cdk4	T	C	10: 126,900,570 (GRCm39)	L112P	probably damaging	Het
Celf2	A	G	2: 6,554,714 (GRCm39)	F425S	probably damaging	Het
Chrm3	A	T	13: 9,927,698 (GRCm39)	V446E	probably benign	Het
Chst9	A	T	18: 15,586,107 (GRCm39)	L152H	probably damaging	Het
Cib2	A	G	9: 54,457,087 (GRCm39)		probably null	Het
Clec18a	T	C	8: 111,798,717 (GRCm39)	S366G	probably damaging	Het
Crebbp	A	G	16: 3,997,983 (GRCm39)	F34L	probably damaging	Het
Dapk1	AT	A	13: 60,870,919 (GRCm39)		probably null	Het
Ddi1	T	A	9: 6,265,761 (GRCm39)	M203L	probably benign	Het
Ddx20	G	T	3: 105,590,485 (GRCm39)	S270R	probably benign	Het
Eddm13	A	T	7: 6,269,317 (GRCm39)	K31*	probably null	Het
Espnl	A	T	1: 91,272,146 (GRCm39)	E458V	probably damaging	Het
Fat3	T	C	9: 15,909,780 (GRCm39)	D2074G	probably damaging	Het
Fcf1	A	G	12: 85,020,902 (GRCm39)	T61A	probably benign	Het
Fkbp15	T	C	4: 62,226,234 (GRCm39)	R772G	probably benign	Het
Flnb	T	C	14: 7,905,661 (GRCm38)	V1137A	probably benign	Het
Fosb	C	A	7: 19,043,313 (GRCm39)	C15F	probably damaging	Het
Frem2	A	T	3: 53,424,162 (GRCm39)	W3092R	probably benign	Het
Gm3248	T	C	14: 5,945,831 (GRCm38)	I28V	probably damaging	Het
Gm4922	G	T	10: 18,659,916 (GRCm39)	L269I	possibly damaging	Het
Gucy2e	G	A	11: 69,119,274 (GRCm39)	R627W	probably damaging	Het
Hephl1	T	A	9: 14,970,467 (GRCm39)	E1009V	probably damaging	Het
Hsf4	A	T	8: 105,997,237 (GRCm39)	Q61L	probably damaging	Het
Itgam	T	A	7: 127,715,445 (GRCm39)	N1046K	probably benign	Het
Itgav	G	A	2: 83,586,154 (GRCm39)	C138Y	probably damaging	Het
Itih4	A	T	14: 30,611,867 (GRCm39)	Y157F	probably damaging	Het
Kcnt2	C	T	1: 140,282,254 (GRCm39)	R80C	probably damaging	Het
Kdm4b	G	A	17: 56,708,618 (GRCm39)	V986M	probably damaging	Het
Lamb3	T	A	1: 193,022,194 (GRCm39)	V1014D	probably damaging	Het
Lrrc74b	G	T	16: 17,367,717 (GRCm39)	N282K	probably damaging	Het
Map3k20	T	A	2: 72,272,048 (GRCm39)	H725Q	probably benign	Het
Mink1	A	G	11: 70,489,867 (GRCm39)	N81S	probably damaging	Het
Mmp21	A	G	7: 133,276,759 (GRCm39)	Y415H	probably damaging	Het
Mycbp2	A	T	14: 103,466,873 (GRCm39)	W1297R	probably damaging	Het
Myh8	T	C	11: 67,170,789 (GRCm39)	M95T	probably damaging	Het
Myo7b	A	T	18: 32,133,158 (GRCm39)		probably null	Het
Nanog	A	G	6: 122,684,874 (GRCm39)	M20V	probably benign	Het
Ncapd3	A	G	9: 26,963,146 (GRCm39)	I484V	probably benign	Het
Ndufa12	A	T	10: 94,056,620 (GRCm39)	N116I	probably benign	Het
Nedd4l	A	G	18: 65,337,016 (GRCm39)	I668V	possibly damaging	Het
Nhsl3	C	A	4: 129,117,095 (GRCm39)	R523L	probably damaging	Het
Nobox	T	C	6: 43,282,480 (GRCm39)	D309G	probably benign	Het
Npnt	A	G	3: 132,596,523 (GRCm39)		probably benign	Het
Nrxn1	A	C	17: 90,762,477 (GRCm39)	Y2D	possibly damaging	Het
Obox6	G	T	7: 15,568,502 (GRCm39)	P125T	possibly damaging	Het
Ofcc1	G	A	13: 40,168,864 (GRCm39)	T841I	probably damaging	Het
Or14j8	T	C	17: 38,263,633 (GRCm39)	Y94C	probably damaging	Het
Or2ag15	C	G	7: 106,340,998 (GRCm39)	V48L	probably benign	Het
Or4s2b	T	A	2: 88,508,731 (GRCm39)	N177K	possibly damaging	Het
Or56a3	T	C	7: 104,735,844 (GRCm39)		probably benign	Het
Or5ac20	A	T	16: 59,104,821 (GRCm39)	V13D	probably damaging	Het
Or5an10	A	G	19: 12,276,305 (GRCm39)	Y64H	possibly damaging	Het
Or8k32	T	C	2: 86,369,224 (GRCm39)	T10A	possibly damaging	Het
Osm	A	T	11: 4,188,435 (GRCm39)	M21L	probably benign	Het
Otogl	T	A	10: 107,657,894 (GRCm39)		probably null	Het
Otud4	T	G	8: 80,393,402 (GRCm39)	S493A	possibly damaging	Het
Pars2	A	G	4: 106,508,308 (GRCm39)		probably benign	Het
Phlda3	T	A	1: 135,694,557 (GRCm39)	V124E	possibly damaging	Het
Pias4	T	C	10: 80,993,326 (GRCm39)	D199G	probably damaging	Het
Pm20d1	T	C	1: 131,739,777 (GRCm39)	L375P	probably benign	Het
Pole2	T	C	12: 69,273,139 (GRCm39)	I48V	probably benign	Het
Prrc2c	T	C	1: 162,538,050 (GRCm39)	R527G	unknown	Het
Rasgrf2	G	T	13: 92,136,135 (GRCm39)	N592K	probably damaging	Het
Rbm7	A	G	9: 48,406,474 (GRCm39)	L26P	probably damaging	Het
Rhag	A	G	17: 41,142,181 (GRCm39)	H208R	probably benign	Het
Rnf17	A	G	14: 56,671,812 (GRCm39)	E268G	probably damaging	Het
Rnf220	A	G	4: 117,146,252 (GRCm39)	V23A	probably benign	Het
Rnf7	A	T	9: 96,360,472 (GRCm39)	V55D	probably damaging	Het
Sdr9c7	C	A	10: 127,739,448 (GRCm39)	R188S	possibly damaging	Het
Senp6	T	A	9: 79,997,140 (GRCm39)	N51K	probably benign	Het
Skint3	C	A	4: 112,113,095 (GRCm39)	T235K	possibly damaging	Het
Slc10a5	A	G	3: 10,400,096 (GRCm39)	F188S	probably damaging	Het
Slc41a1	G	A	1: 131,758,690 (GRCm39)	G111R	probably damaging	Het
Smarca1	T	C	X: 46,972,944 (GRCm39)	D132G	probably null	Het
Snrnp48	C	T	13: 38,405,299 (GRCm39)	R299W	probably damaging	Het
Star	T	A	8: 26,298,644 (GRCm39)	H16Q	probably damaging	Het
Strc	T	C	2: 121,206,075 (GRCm39)	D779G	probably benign	Het
Sulf2	T	C	2: 165,931,215 (GRCm39)	Y264C	probably damaging	Het
Supt7l	A	G	5: 31,680,248 (GRCm39)	S6P	possibly damaging	Het
Syne2	A	G	12: 76,067,165 (GRCm39)	D4289G	probably benign	Het
Szrd1	A	T	4: 140,867,001 (GRCm39)		probably null	Het
Tada1	T	C	1: 166,219,523 (GRCm39)	V275A	possibly damaging	Het
Tbr1	A	T	2: 61,641,932 (GRCm39)	Y136F	probably benign	Het
Tbx20	T	A	9: 24,637,010 (GRCm39)	H359L	probably benign	Het
Thbs4	G	T	13: 92,899,314 (GRCm39)	D560E	probably damaging	Het
Tnfsf14	T	C	17: 57,497,740 (GRCm39)	H164R	probably damaging	Het
Trmu	T	C	15: 85,767,006 (GRCm39)	S72P	probably damaging	Het
Tsnaxip1	C	A	8: 106,560,155 (GRCm39)	Q36K	probably benign	Het
Ttc28	T	A	5: 111,372,083 (GRCm39)	M844K	possibly damaging	Het
Tubgcp2	T	C	7: 139,579,201 (GRCm39)	Y695C	probably damaging	Het
Ugt1a10	T	A	1: 87,984,009 (GRCm39)	M269K	probably damaging	Het
Urb1	A	T	16: 90,566,443 (GRCm39)	L1448*	probably null	Het
Vmn2r124	A	T	17: 18,269,855 (GRCm39)	H37L	probably damaging	Het
Vmn2r44	T	C	7: 8,370,949 (GRCm39)	N699S	probably damaging	Het
Vps35	A	T	8: 86,005,486 (GRCm39)		probably null	Het
Yipf1	G	T	4: 107,193,396 (GRCm39)		probably null	Het
Zfp395	A	G	14: 65,623,990 (GRCm39)	N153S	possibly damaging	Het
Zfp395	A	G	14: 65,630,656 (GRCm39)	D402G	probably damaging	Het
Zfp652	T	C	11: 95,640,435 (GRCm39)	V120A	probably damaging	Het
Zp3r	T	C	1: 130,510,629 (GRCm39)	I364M	probably damaging	Het

Other mutations in Sspo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Sspo	APN	6	48,447,387 (GRCm39)	missense	probably benign	0.02
IGL00339:Sspo	APN	6	48,460,680 (GRCm39)	splice site	probably benign
IGL00391:Sspo	APN	6	48,474,320 (GRCm39)	missense	probably damaging	0.96
IGL00433:Sspo	APN	6	48,466,970 (GRCm39)	missense	probably damaging	1.00
IGL00471:Sspo	APN	6	48,475,147 (GRCm39)	splice site	probably benign
IGL00500:Sspo	APN	6	48,474,355 (GRCm39)	nonsense	probably null
IGL00537:Sspo	APN	6	48,475,147 (GRCm39)	splice site	probably benign
IGL00540:Sspo	APN	6	48,475,147 (GRCm39)	splice site	probably benign
IGL01060:Sspo	APN	6	48,426,413 (GRCm39)	nonsense	probably null
IGL01090:Sspo	APN	6	48,467,059 (GRCm39)	missense	probably benign	0.08
IGL01125:Sspo	APN	6	48,469,822 (GRCm39)	missense	probably damaging	1.00
IGL01447:Sspo	APN	6	48,441,600 (GRCm39)	splice site	probably null
IGL01457:Sspo	APN	6	48,475,277 (GRCm39)	missense	probably benign	0.00
IGL01481:Sspo	APN	6	48,425,449 (GRCm39)	missense	probably benign	0.41
IGL01485:Sspo	APN	6	48,455,665 (GRCm39)	missense	probably damaging	1.00
IGL01544:Sspo	APN	6	48,467,953 (GRCm39)	missense	probably damaging	0.99
IGL01575:Sspo	APN	6	48,435,976 (GRCm39)	missense	probably benign	0.01
IGL01589:Sspo	APN	6	48,428,112 (GRCm39)	missense	probably damaging	1.00
IGL01601:Sspo	APN	6	48,463,313 (GRCm39)	missense	probably benign	0.33
IGL01644:Sspo	APN	6	48,429,436 (GRCm39)	missense	probably benign
IGL01659:Sspo	APN	6	48,451,377 (GRCm39)	missense	probably damaging	1.00
IGL01801:Sspo	APN	6	48,434,072 (GRCm39)	missense	probably damaging	1.00
IGL01872:Sspo	APN	6	48,431,623 (GRCm39)	missense	probably damaging	0.99
IGL01874:Sspo	APN	6	48,429,124 (GRCm39)	missense	probably damaging	1.00
IGL01936:Sspo	APN	6	48,452,821 (GRCm39)	missense	probably damaging	1.00
IGL01941:Sspo	APN	6	48,472,116 (GRCm39)	missense	probably benign	0.19
IGL01986:Sspo	APN	6	48,460,237 (GRCm39)	missense	probably benign	0.05
IGL01987:Sspo	APN	6	48,454,558 (GRCm39)	splice site	probably null
IGL02170:Sspo	APN	6	48,444,917 (GRCm39)	missense	possibly damaging	0.76
IGL02192:Sspo	APN	6	48,436,502 (GRCm39)	missense	possibly damaging	0.86
IGL02210:Sspo	APN	6	48,477,426 (GRCm39)	missense	probably damaging	1.00
IGL02225:Sspo	APN	6	48,461,268 (GRCm39)	missense	probably benign	0.09
IGL02280:Sspo	APN	6	48,473,165 (GRCm39)	missense	probably damaging	1.00
IGL02303:Sspo	APN	6	48,461,639 (GRCm39)	missense	possibly damaging	0.52
IGL02397:Sspo	APN	6	48,438,572 (GRCm39)	missense	probably benign	0.35
IGL02451:Sspo	APN	6	48,437,237 (GRCm39)	splice site	probably benign
IGL02500:Sspo	APN	6	48,455,313 (GRCm39)	nonsense	probably null
IGL02519:Sspo	APN	6	48,461,762 (GRCm39)	missense	probably damaging	1.00
IGL02549:Sspo	APN	6	48,428,707 (GRCm39)	missense	possibly damaging	0.81
IGL02562:Sspo	APN	6	48,467,056 (GRCm39)	splice site	probably null
IGL02673:Sspo	APN	6	48,475,709 (GRCm39)	critical splice donor site	probably null
IGL02673:Sspo	APN	6	48,452,794 (GRCm39)	missense	probably damaging	1.00
IGL02719:Sspo	APN	6	48,459,601 (GRCm39)	missense	probably benign	0.39
IGL02793:Sspo	APN	6	48,464,828 (GRCm39)	splice site	probably benign
IGL03003:Sspo	APN	6	48,432,021 (GRCm39)	missense	probably damaging	0.98
IGL03056:Sspo	APN	6	48,447,472 (GRCm39)	missense	probably benign	0.17
IGL03105:Sspo	APN	6	48,450,592 (GRCm39)	splice site	probably benign
IGL03116:Sspo	APN	6	48,471,035 (GRCm39)	missense	probably benign	0.32
IGL03163:Sspo	APN	6	48,461,266 (GRCm39)	missense	probably benign	0.19
IGL03198:Sspo	APN	6	48,454,516 (GRCm39)	missense	probably benign	0.31
IGL03365:Sspo	APN	6	48,436,349 (GRCm39)	missense	possibly damaging	0.82
Barrier	UTSW	6	48,472,146 (GRCm39)	missense	possibly damaging	0.58
R0312_sspo_280	UTSW	6	48,432,335 (GRCm39)	missense	possibly damaging	0.52
R3112_Sspo_731	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R3498_Sspo_650	UTSW	6	48,444,914 (GRCm39)	missense	possibly damaging	0.58
R4180_Sspo_324	UTSW	6	48,475,329 (GRCm39)	critical splice donor site	probably null
spotsylvania	UTSW	6	48,453,505 (GRCm39)	nonsense	probably null
ANU74:Sspo	UTSW	6	48,437,893 (GRCm39)	missense	probably damaging	1.00
IGL02984:Sspo	UTSW	6	48,472,089 (GRCm39)	missense	probably benign	0.33
IGL03052:Sspo	UTSW	6	48,437,387 (GRCm39)	missense	probably damaging	1.00
IGL03134:Sspo	UTSW	6	48,427,999 (GRCm39)	missense	probably benign	0.28
PIT4531001:Sspo	UTSW	6	48,458,173 (GRCm39)	missense	probably benign
R0087:Sspo	UTSW	6	48,454,719 (GRCm39)	missense	probably damaging	1.00
R0122:Sspo	UTSW	6	48,450,910 (GRCm39)	missense	possibly damaging	0.95
R0129:Sspo	UTSW	6	48,432,352 (GRCm39)	missense	probably benign	0.00
R0164:Sspo	UTSW	6	48,471,128 (GRCm39)	splice site	probably benign
R0195:Sspo	UTSW	6	48,463,570 (GRCm39)	missense	probably benign
R0200:Sspo	UTSW	6	48,463,349 (GRCm39)	missense	probably null	0.01
R0201:Sspo	UTSW	6	48,432,686 (GRCm39)	missense	possibly damaging	0.64
R0241:Sspo	UTSW	6	48,438,429 (GRCm39)	missense	possibly damaging	0.82
R0241:Sspo	UTSW	6	48,438,429 (GRCm39)	missense	possibly damaging	0.82
R0243:Sspo	UTSW	6	48,470,120 (GRCm39)	missense	probably damaging	1.00
R0268:Sspo	UTSW	6	48,442,489 (GRCm39)	missense	probably benign	0.26
R0312:Sspo	UTSW	6	48,432,335 (GRCm39)	missense	possibly damaging	0.52
R0449:Sspo	UTSW	6	48,443,674 (GRCm39)	missense	probably damaging	1.00
R0523:Sspo	UTSW	6	48,428,794 (GRCm39)	missense	probably benign	0.20
R0576:Sspo	UTSW	6	48,441,876 (GRCm39)	splice site	probably null
R0671:Sspo	UTSW	6	48,467,325 (GRCm39)	splice site	probably benign
R0828:Sspo	UTSW	6	48,475,668 (GRCm39)	missense	probably damaging	1.00
R0880:Sspo	UTSW	6	48,452,869 (GRCm39)	missense	possibly damaging	0.69
R0903:Sspo	UTSW	6	48,432,242 (GRCm39)	critical splice acceptor site	probably null
R1051:Sspo	UTSW	6	48,468,389 (GRCm39)	nonsense	probably null
R1083:Sspo	UTSW	6	48,447,933 (GRCm39)	missense	possibly damaging	0.91
R1109:Sspo	UTSW	6	48,474,377 (GRCm39)	missense	probably damaging	1.00
R1118:Sspo	UTSW	6	48,436,352 (GRCm39)	missense	probably damaging	0.97
R1256:Sspo	UTSW	6	48,434,573 (GRCm39)	missense	probably damaging	1.00
R1342:Sspo	UTSW	6	48,438,569 (GRCm39)	missense	probably benign	0.07
R1355:Sspo	UTSW	6	48,425,560 (GRCm39)	missense	probably benign	0.41
R1370:Sspo	UTSW	6	48,425,560 (GRCm39)	missense	probably benign	0.41
R1469:Sspo	UTSW	6	48,467,916 (GRCm39)	missense	probably damaging	1.00
R1469:Sspo	UTSW	6	48,467,916 (GRCm39)	missense	probably damaging	1.00
R1476:Sspo	UTSW	6	48,440,334 (GRCm39)	critical splice donor site	probably null
R1566:Sspo	UTSW	6	48,443,804 (GRCm39)	critical splice donor site	probably null
R1630:Sspo	UTSW	6	48,434,658 (GRCm39)	missense	probably benign	0.01
R1686:Sspo	UTSW	6	48,437,334 (GRCm39)	missense	probably benign	0.00
R1707:Sspo	UTSW	6	48,454,811 (GRCm39)	missense	probably damaging	0.99
R1727:Sspo	UTSW	6	48,471,782 (GRCm39)	missense	probably damaging	1.00
R1822:Sspo	UTSW	6	48,469,820 (GRCm39)	missense	possibly damaging	0.75
R1831:Sspo	UTSW	6	48,466,720 (GRCm39)	missense	probably damaging	1.00
R1835:Sspo	UTSW	6	48,434,274 (GRCm39)	missense	probably damaging	0.97
R1862:Sspo	UTSW	6	48,467,940 (GRCm39)	missense	probably damaging	0.98
R1878:Sspo	UTSW	6	48,436,300 (GRCm39)	missense	possibly damaging	0.92
R1900:Sspo	UTSW	6	48,436,284 (GRCm39)	missense	probably benign	0.22
R1945:Sspo	UTSW	6	48,466,707 (GRCm39)	missense	possibly damaging	0.93
R1957:Sspo	UTSW	6	48,455,207 (GRCm39)	missense	probably damaging	0.99
R1990:Sspo	UTSW	6	48,427,984 (GRCm39)	missense	probably benign	0.00
R1996:Sspo	UTSW	6	48,452,424 (GRCm39)	missense	possibly damaging	0.50
R2049:Sspo	UTSW	6	48,440,465 (GRCm39)	missense	probably benign	0.36
R2049:Sspo	UTSW	6	48,437,697 (GRCm39)	splice site	probably benign
R2064:Sspo	UTSW	6	48,450,596 (GRCm39)	missense	probably damaging	0.99
R2072:Sspo	UTSW	6	48,450,451 (GRCm39)	missense	probably benign	0.01
R2096:Sspo	UTSW	6	48,438,608 (GRCm39)	missense	probably benign
R2106:Sspo	UTSW	6	48,443,250 (GRCm39)	missense	possibly damaging	0.96
R2230:Sspo	UTSW	6	48,477,437 (GRCm39)	missense	probably benign	0.11
R2230:Sspo	UTSW	6	48,425,606 (GRCm39)	missense	probably damaging	0.97
R2232:Sspo	UTSW	6	48,425,606 (GRCm39)	missense	probably damaging	0.97
R2351:Sspo	UTSW	6	48,441,803 (GRCm39)	missense	probably damaging	1.00
R2423:Sspo	UTSW	6	48,430,989 (GRCm39)	missense	probably benign	0.00
R2508:Sspo	UTSW	6	48,441,298 (GRCm39)	missense	probably damaging	1.00
R3110:Sspo	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R3112:Sspo	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R3413:Sspo	UTSW	6	48,457,631 (GRCm39)	missense	probably damaging	1.00
R3433:Sspo	UTSW	6	48,452,885 (GRCm39)	splice site	probably null
R3498:Sspo	UTSW	6	48,444,914 (GRCm39)	missense	possibly damaging	0.58
R3732:Sspo	UTSW	6	48,426,864 (GRCm39)	missense	probably damaging	1.00
R3816:Sspo	UTSW	6	48,458,037 (GRCm39)	missense	possibly damaging	0.77
R3818:Sspo	UTSW	6	48,458,037 (GRCm39)	missense	possibly damaging	0.77
R3819:Sspo	UTSW	6	48,458,037 (GRCm39)	missense	possibly damaging	0.77
R3838:Sspo	UTSW	6	48,457,754 (GRCm39)	missense	probably damaging	1.00
R3850:Sspo	UTSW	6	48,469,424 (GRCm39)	missense	probably damaging	1.00
R3880:Sspo	UTSW	6	48,471,874 (GRCm39)	missense	probably benign	0.38
R3893:Sspo	UTSW	6	48,453,505 (GRCm39)	nonsense	probably null
R4116:Sspo	UTSW	6	48,433,928 (GRCm39)	missense	probably damaging	0.99
R4179:Sspo	UTSW	6	48,475,329 (GRCm39)	critical splice donor site	probably null
R4180:Sspo	UTSW	6	48,475,329 (GRCm39)	critical splice donor site	probably null
R4207:Sspo	UTSW	6	48,455,227 (GRCm39)	missense	probably benign	0.00
R4210:Sspo	UTSW	6	48,441,835 (GRCm39)	missense	probably benign	0.00
R4223:Sspo	UTSW	6	48,428,091 (GRCm39)	missense	possibly damaging	0.54
R4224:Sspo	UTSW	6	48,428,091 (GRCm39)	missense	possibly damaging	0.54
R4225:Sspo	UTSW	6	48,428,091 (GRCm39)	missense	possibly damaging	0.54
R4229:Sspo	UTSW	6	48,467,868 (GRCm39)	missense	probably benign	0.00
R4230:Sspo	UTSW	6	48,467,868 (GRCm39)	missense	probably benign	0.00
R4363:Sspo	UTSW	6	48,475,665 (GRCm39)	missense	probably damaging	1.00
R4370:Sspo	UTSW	6	48,443,282 (GRCm39)	missense	probably null	0.14
R4407:Sspo	UTSW	6	48,437,454 (GRCm39)	missense	probably damaging	1.00
R4438:Sspo	UTSW	6	48,464,287 (GRCm39)	missense	probably damaging	1.00
R4454:Sspo	UTSW	6	48,464,159 (GRCm39)	missense	probably benign	0.05
R4455:Sspo	UTSW	6	48,442,450 (GRCm39)	missense	probably damaging	1.00
R4561:Sspo	UTSW	6	48,452,468 (GRCm39)	splice site	probably null
R4574:Sspo	UTSW	6	48,442,457 (GRCm39)	missense	probably damaging	1.00
R4578:Sspo	UTSW	6	48,440,307 (GRCm39)	missense	possibly damaging	0.58
R4653:Sspo	UTSW	6	48,455,580 (GRCm39)	missense	probably damaging	1.00
R4656:Sspo	UTSW	6	48,431,010 (GRCm39)	missense	possibly damaging	0.65
R4659:Sspo	UTSW	6	48,461,147 (GRCm39)	missense	probably damaging	1.00
R4664:Sspo	UTSW	6	48,450,468 (GRCm39)	missense	possibly damaging	0.82
R4685:Sspo	UTSW	6	48,469,828 (GRCm39)	missense	probably damaging	0.98
R4692:Sspo	UTSW	6	48,459,621 (GRCm39)	missense	probably damaging	1.00
R4703:Sspo	UTSW	6	48,477,387 (GRCm39)	missense	probably damaging	1.00
R4704:Sspo	UTSW	6	48,475,638 (GRCm39)	missense	probably damaging	1.00
R4738:Sspo	UTSW	6	48,455,330 (GRCm39)	missense	possibly damaging	0.78
R4766:Sspo	UTSW	6	48,447,514 (GRCm39)	missense	probably benign	0.04
R4771:Sspo	UTSW	6	48,437,813 (GRCm39)	missense	probably damaging	1.00
R4792:Sspo	UTSW	6	48,438,519 (GRCm39)	missense	probably benign	0.00
R4808:Sspo	UTSW	6	48,428,095 (GRCm39)	missense	probably damaging	1.00
R4812:Sspo	UTSW	6	48,467,444 (GRCm39)	missense	probably benign	0.00
R4883:Sspo	UTSW	6	48,437,756 (GRCm39)	missense	probably benign	0.00
R4906:Sspo	UTSW	6	48,442,664 (GRCm39)	critical splice acceptor site	probably null
R4934:Sspo	UTSW	6	48,442,486 (GRCm39)	missense	probably damaging	1.00
R4945:Sspo	UTSW	6	48,444,021 (GRCm39)	splice site	probably null
R4967:Sspo	UTSW	6	48,441,539 (GRCm39)	missense	probably damaging	0.97
R5016:Sspo	UTSW	6	48,429,214 (GRCm39)	nonsense	probably null
R5018:Sspo	UTSW	6	48,432,634 (GRCm39)	missense	probably damaging	1.00
R5034:Sspo	UTSW	6	48,457,757 (GRCm39)	missense	possibly damaging	0.93
R5044:Sspo	UTSW	6	48,443,889 (GRCm39)	critical splice acceptor site	probably null
R5055:Sspo	UTSW	6	48,441,729 (GRCm39)	missense	probably damaging	1.00
R5087:Sspo	UTSW	6	48,465,405 (GRCm39)	missense	possibly damaging	0.51
R5155:Sspo	UTSW	6	48,437,408 (GRCm39)	missense	probably benign	0.03
R5223:Sspo	UTSW	6	48,455,258 (GRCm39)	missense	probably damaging	1.00
R5249:Sspo	UTSW	6	48,470,244 (GRCm39)	missense	probably damaging	0.98
R5257:Sspo	UTSW	6	48,453,428 (GRCm39)	missense	probably damaging	1.00
R5258:Sspo	UTSW	6	48,453,428 (GRCm39)	missense	probably damaging	1.00
R5276:Sspo	UTSW	6	48,467,401 (GRCm39)	missense	probably damaging	1.00
R5307:Sspo	UTSW	6	48,431,784 (GRCm39)	missense	probably damaging	0.99
R5341:Sspo	UTSW	6	48,436,549 (GRCm39)	missense	probably damaging	1.00
R5361:Sspo	UTSW	6	48,443,247 (GRCm39)	missense	probably benign	0.02
R5385:Sspo	UTSW	6	48,439,187 (GRCm39)	missense	probably benign	0.18
R5394:Sspo	UTSW	6	48,472,194 (GRCm39)	missense	possibly damaging	0.52
R5477:Sspo	UTSW	6	48,475,327 (GRCm39)	missense	possibly damaging	0.60
R5490:Sspo	UTSW	6	48,470,214 (GRCm39)	missense	probably benign	0.33
R5512:Sspo	UTSW	6	48,432,605 (GRCm39)	missense	probably damaging	0.97
R5518:Sspo	UTSW	6	48,473,588 (GRCm39)	missense	possibly damaging	0.92
R5530:Sspo	UTSW	6	48,442,517 (GRCm39)	missense	probably damaging	0.97
R5538:Sspo	UTSW	6	48,429,112 (GRCm39)	missense	probably damaging	0.99
R5590:Sspo	UTSW	6	48,451,425 (GRCm39)	missense	probably damaging	1.00
R5613:Sspo	UTSW	6	48,431,978 (GRCm39)	missense	possibly damaging	0.79
R5638:Sspo	UTSW	6	48,469,825 (GRCm39)	missense	possibly damaging	0.86
R5809:Sspo	UTSW	6	48,436,979 (GRCm39)	missense	possibly damaging	0.59
R5810:Sspo	UTSW	6	48,460,832 (GRCm39)	missense	probably benign	0.02
R5814:Sspo	UTSW	6	48,428,818 (GRCm39)	missense	probably damaging	1.00
R5915:Sspo	UTSW	6	48,468,418 (GRCm39)	missense	possibly damaging	0.83
R5915:Sspo	UTSW	6	48,441,530 (GRCm39)	missense	probably benign	0.00
R5979:Sspo	UTSW	6	48,440,627 (GRCm39)	missense	probably benign	0.20
R5996:Sspo	UTSW	6	48,471,110 (GRCm39)	missense	possibly damaging	0.87
R6012:Sspo	UTSW	6	48,428,305 (GRCm39)	missense	probably benign	0.00
R6025:Sspo	UTSW	6	48,463,720 (GRCm39)	missense	possibly damaging	0.83
R6120:Sspo	UTSW	6	48,442,510 (GRCm39)	missense	probably damaging	1.00
R6150:Sspo	UTSW	6	48,463,313 (GRCm39)	missense	probably benign	0.33
R6221:Sspo	UTSW	6	48,440,639 (GRCm39)	missense	probably damaging	1.00
R6261:Sspo	UTSW	6	48,439,125 (GRCm39)	missense	possibly damaging	0.75
R6312:Sspo	UTSW	6	48,434,300 (GRCm39)	critical splice donor site	probably null
R6372:Sspo	UTSW	6	48,449,475 (GRCm39)	missense	probably damaging	1.00
R6456:Sspo	UTSW	6	48,428,740 (GRCm39)	missense	probably benign	0.08
R6497:Sspo	UTSW	6	48,472,142 (GRCm39)	missense	possibly damaging	0.71
R6501:Sspo	UTSW	6	48,472,146 (GRCm39)	missense	possibly damaging	0.58
R6617:Sspo	UTSW	6	48,467,980 (GRCm39)	missense	possibly damaging	0.93
R6825:Sspo	UTSW	6	48,442,459 (GRCm39)	missense	probably benign	0.04
R6831:Sspo	UTSW	6	48,461,767 (GRCm39)	missense	possibly damaging	0.68
R6861:Sspo	UTSW	6	48,464,889 (GRCm39)	missense	probably benign	0.15
R6961:Sspo	UTSW	6	48,440,811 (GRCm39)	missense	probably benign	0.05
R6967:Sspo	UTSW	6	48,466,728 (GRCm39)	missense	probably benign	0.21
R7016:Sspo	UTSW	6	48,426,098 (GRCm39)	missense	probably damaging	1.00
R7035:Sspo	UTSW	6	48,426,147 (GRCm39)	splice site	probably null
R7058:Sspo	UTSW	6	48,425,516 (GRCm39)	missense	probably damaging	1.00
R7072:Sspo	UTSW	6	48,431,913 (GRCm39)	missense	probably damaging	1.00
R7078:Sspo	UTSW	6	48,437,313 (GRCm39)	missense	probably damaging	1.00
R7082:Sspo	UTSW	6	48,455,543 (GRCm39)	critical splice acceptor site	probably null
R7120:Sspo	UTSW	6	48,442,505 (GRCm39)	missense	probably benign	0.05
R7127:Sspo	UTSW	6	48,426,446 (GRCm39)	missense	probably benign	0.02
R7146:Sspo	UTSW	6	48,478,029 (GRCm39)	missense	probably benign	0.15
R7220:Sspo	UTSW	6	48,453,540 (GRCm39)	nonsense	probably null
R7242:Sspo	UTSW	6	48,450,886 (GRCm39)	missense	probably benign
R7261:Sspo	UTSW	6	48,427,011 (GRCm39)	missense	possibly damaging	0.52
R7313:Sspo	UTSW	6	48,450,390 (GRCm39)	missense	probably benign	0.04
R7313:Sspo	UTSW	6	48,431,762 (GRCm39)	missense	probably damaging	1.00
R7323:Sspo	UTSW	6	48,438,581 (GRCm39)	missense	possibly damaging	0.93
R7330:Sspo	UTSW	6	48,452,396 (GRCm39)	missense	probably benign	0.00
R7351:Sspo	UTSW	6	48,441,855 (GRCm39)	missense	possibly damaging	0.89
R7467:Sspo	UTSW	6	48,463,237 (GRCm39)	missense	probably damaging	1.00
R7475:Sspo	UTSW	6	48,432,794 (GRCm39)	missense	probably benign	0.37
R7489:Sspo	UTSW	6	48,450,647 (GRCm39)	missense	probably damaging	0.99
R7508:Sspo	UTSW	6	48,443,633 (GRCm39)	missense	probably damaging	1.00
R7515:Sspo	UTSW	6	48,470,820 (GRCm39)	missense	probably damaging	1.00
R7564:Sspo	UTSW	6	48,426,434 (GRCm39)	missense	probably benign	0.04
R7607:Sspo	UTSW	6	48,466,661 (GRCm39)	missense	probably damaging	1.00
R7620:Sspo	UTSW	6	48,444,020 (GRCm39)	critical splice donor site	probably null
R7667:Sspo	UTSW	6	48,452,305 (GRCm39)	nonsense	probably null
R7691:Sspo	UTSW	6	48,461,163 (GRCm39)	missense	probably benign	0.12
R7707:Sspo	UTSW	6	48,438,461 (GRCm39)	missense	probably benign	0.01
R7723:Sspo	UTSW	6	48,441,572 (GRCm39)	missense	probably damaging	0.99
R7748:Sspo	UTSW	6	48,426,399 (GRCm39)	nonsense	probably null
R7767:Sspo	UTSW	6	48,428,316 (GRCm39)	missense	probably damaging	0.96
R7792:Sspo	UTSW	6	48,431,624 (GRCm39)	missense	probably damaging	0.98
R7878:Sspo	UTSW	6	48,469,460 (GRCm39)	missense	probably damaging	1.00
R7893:Sspo	UTSW	6	48,440,244 (GRCm39)	missense	probably benign	0.02
R7942:Sspo	UTSW	6	48,465,434 (GRCm39)	splice site	probably null
R7952:Sspo	UTSW	6	48,464,263 (GRCm39)	missense	probably damaging	1.00
R7981:Sspo	UTSW	6	48,445,428 (GRCm39)	missense	probably benign
R7995:Sspo	UTSW	6	48,469,823 (GRCm39)	missense	probably damaging	1.00
R8088:Sspo	UTSW	6	48,434,547 (GRCm39)	missense	probably damaging	1.00
R8129:Sspo	UTSW	6	48,443,959 (GRCm39)	missense	possibly damaging	0.79
R8145:Sspo	UTSW	6	48,444,683 (GRCm39)	missense	possibly damaging	0.49
R8202:Sspo	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R8211:Sspo	UTSW	6	48,469,543 (GRCm39)	critical splice donor site	probably null
R8240:Sspo	UTSW	6	48,460,436 (GRCm39)	missense	possibly damaging	0.84
R8252:Sspo	UTSW	6	48,462,386 (GRCm39)	missense	probably damaging	0.99
R8270:Sspo	UTSW	6	48,426,897 (GRCm39)	missense	probably benign
R8272:Sspo	UTSW	6	48,425,453 (GRCm39)	missense	probably benign	0.03
R8316:Sspo	UTSW	6	48,459,622 (GRCm39)	missense	probably damaging	1.00
R8384:Sspo	UTSW	6	48,459,598 (GRCm39)	missense	probably damaging	1.00
R8390:Sspo	UTSW	6	48,444,896 (GRCm39)	missense	probably benign	0.00
R8770:Sspo	UTSW	6	48,451,206 (GRCm39)	missense	probably null	1.00
R8827:Sspo	UTSW	6	48,434,606 (GRCm39)	missense	possibly damaging	0.59
R8882:Sspo	UTSW	6	48,452,390 (GRCm39)	missense	probably damaging	1.00
R8886:Sspo	UTSW	6	48,458,201 (GRCm39)	missense	possibly damaging	0.92
R8946:Sspo	UTSW	6	48,434,071 (GRCm39)	missense	probably damaging	1.00
R8947:Sspo	UTSW	6	48,425,504 (GRCm39)	missense	probably damaging	1.00
R9028:Sspo	UTSW	6	48,473,087 (GRCm39)	missense	probably benign	0.38
R9043:Sspo	UTSW	6	48,470,214 (GRCm39)	missense	probably benign	0.07
R9056:Sspo	UTSW	6	48,450,608 (GRCm39)	missense	probably damaging	0.97
R9071:Sspo	UTSW	6	48,433,982 (GRCm39)	missense	probably benign	0.00
R9133:Sspo	UTSW	6	48,434,747 (GRCm39)	missense	possibly damaging	0.81
R9187:Sspo	UTSW	6	48,472,223 (GRCm39)	missense	probably damaging	1.00
R9205:Sspo	UTSW	6	48,432,806 (GRCm39)	missense	probably benign	0.03
R9213:Sspo	UTSW	6	48,440,869 (GRCm39)	missense	possibly damaging	0.91
R9214:Sspo	UTSW	6	48,440,869 (GRCm39)	missense	possibly damaging	0.91
R9215:Sspo	UTSW	6	48,440,869 (GRCm39)	missense	possibly damaging	0.91
R9235:Sspo	UTSW	6	48,466,718 (GRCm39)	missense	probably damaging	1.00
R9254:Sspo	UTSW	6	48,464,928 (GRCm39)	missense	probably damaging	1.00
R9291:Sspo	UTSW	6	48,473,330 (GRCm39)	missense	probably damaging	1.00
R9312:Sspo	UTSW	6	48,445,396 (GRCm39)	missense	probably benign	0.00
R9357:Sspo	UTSW	6	48,443,989 (GRCm39)	missense	possibly damaging	0.77
R9480:Sspo	UTSW	6	48,470,820 (GRCm39)	missense	probably damaging	1.00
R9586:Sspo	UTSW	6	48,458,039 (GRCm39)	missense	probably benign	0.03
R9660:Sspo	UTSW	6	48,432,707 (GRCm39)	missense	probably damaging	1.00
R9661:Sspo	UTSW	6	48,455,272 (GRCm39)	nonsense	probably null
R9728:Sspo	UTSW	6	48,432,707 (GRCm39)	missense	probably damaging	1.00
R9776:Sspo	UTSW	6	48,439,269 (GRCm39)	missense	probably benign	0.00
RF009:Sspo	UTSW	6	48,436,919 (GRCm39)	nonsense	probably null
X0060:Sspo	UTSW	6	48,457,728 (GRCm39)	missense	probably damaging	1.00
X0060:Sspo	UTSW	6	48,443,228 (GRCm39)	missense	probably damaging	1.00
X0063:Sspo	UTSW	6	48,474,356 (GRCm39)	missense	probably damaging	0.96
X0065:Sspo	UTSW	6	48,438,618 (GRCm39)	missense	probably benign	0.00
Z1176:Sspo	UTSW	6	48,458,227 (GRCm39)	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48,467,824 (GRCm39)	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48,467,482 (GRCm39)	nonsense	probably null
Z1177:Sspo	UTSW	6	48,450,369 (GRCm39)	missense	probably damaging	0.99
Z1177:Sspo	UTSW	6	48,447,918 (GRCm39)	missense	probably benign	0.16
Z1177:Sspo	UTSW	6	48,441,750 (GRCm39)	missense	possibly damaging	0.72
Z1177:Sspo	UTSW	6	48,433,960 (GRCm39)	missense	probably benign	0.31
Z1186:Sspo	UTSW	6	48,445,441 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACTGAAGCTGCCGCATCTG -3'
(R):5'- TCTTCATCTGCAGCATCCAG -3'

Sequencing Primer
(F):5'- ATCTGGCCCCAGGGTGG -3'
(R):5'- TGCAGCATCCAGACAGTCAGG -3'

Posted On

2017-04-14