Incidental Mutation 'R0503:Gria1'
ID47271
Institutional Source Beutler Lab
Gene Symbol Gria1
Ensembl Gene ENSMUSG00000020524
Gene Nameglutamate receptor, ionotropic, AMPA1 (alpha 1)
SynonymsGlr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location57011387-57330244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57189716 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 175 (V175G)
Ref Sequence ENSEMBL: ENSMUSP00000091731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]
Predicted Effect probably damaging
Transcript: ENSMUST00000036315
AA Change: V175G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: V175G

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 9.3e-63 PFAM
PBPe 408 783 3.65e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094179
AA Change: V175G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524
AA Change: V175G

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 3.7e-69 PFAM
PBPe 408 783 2.09e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151045
AA Change: V106G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: V106G

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 303 4.7e-58 PFAM
PBPe 339 714 3.65e-121 SMART
Lig_chan-Glu_bd 349 414 1.65e-29 SMART
transmembrane domain 739 761 N/A INTRINSIC
low complexity region 794 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173531
Meta Mutation Damage Score 0.4531 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Gria1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Gria1 APN 11 57242941 nonsense probably null
IGL00807:Gria1 APN 11 57012040 missense probably benign
IGL00816:Gria1 APN 11 57317742 missense possibly damaging 0.93
IGL01110:Gria1 APN 11 57289381 missense probably damaging 1.00
IGL01116:Gria1 APN 11 57236975 missense probably damaging 1.00
IGL01120:Gria1 APN 11 57317669 missense probably damaging 0.99
IGL01843:Gria1 APN 11 57317774 missense probably damaging 1.00
IGL02135:Gria1 APN 11 57185853 missense probably damaging 1.00
IGL02308:Gria1 APN 11 57236924 missense probably benign 0.00
IGL02554:Gria1 APN 11 57289488 missense possibly damaging 0.72
IGL02813:Gria1 APN 11 57283584 missense probably damaging 1.00
IGL03071:Gria1 APN 11 57012110 unclassified probably null
IGL03326:Gria1 APN 11 57317773 missense probably damaging 1.00
PIT4445001:Gria1 UTSW 11 57185838 missense probably damaging 1.00
R0087:Gria1 UTSW 11 57317712 missense probably damaging 1.00
R0387:Gria1 UTSW 11 57309884 critical splice donor site probably null
R0399:Gria1 UTSW 11 57186027 missense probably damaging 0.97
R0502:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0549:Gria1 UTSW 11 57228973 missense probably damaging 1.00
R0590:Gria1 UTSW 11 57289409 missense probably damaging 1.00
R1377:Gria1 UTSW 11 57201176 missense probably damaging 1.00
R1395:Gria1 UTSW 11 57283566 missense probably damaging 1.00
R1422:Gria1 UTSW 11 57189788 missense probably benign 0.00
R1581:Gria1 UTSW 11 57237010 splice site probably null
R2002:Gria1 UTSW 11 57012104 missense possibly damaging 0.93
R2064:Gria1 UTSW 11 57317708 missense probably damaging 0.98
R2255:Gria1 UTSW 11 57185949 missense probably damaging 1.00
R2507:Gria1 UTSW 11 57289320 missense probably null 0.30
R2965:Gria1 UTSW 11 57185801 nonsense probably null
R3012:Gria1 UTSW 11 57289434 missense probably damaging 1.00
R3151:Gria1 UTSW 11 57283562 missense probably damaging 1.00
R3807:Gria1 UTSW 11 57310678 missense probably damaging 1.00
R5026:Gria1 UTSW 11 57310696 missense probably damaging 1.00
R5132:Gria1 UTSW 11 57289399 missense probably damaging 1.00
R5222:Gria1 UTSW 11 57189797 missense probably benign 0.22
R5303:Gria1 UTSW 11 57243025 missense probably benign 0.01
R5332:Gria1 UTSW 11 57327621 missense possibly damaging 0.93
R5413:Gria1 UTSW 11 57217794 missense probably benign 0.00
R5748:Gria1 UTSW 11 57309876 missense probably benign 0.00
R5878:Gria1 UTSW 11 57317802 critical splice donor site probably null
R5937:Gria1 UTSW 11 57189733 missense probably benign 0.00
R5995:Gria1 UTSW 11 57289285 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6180:Gria1 UTSW 11 57242792 missense probably damaging 1.00
R6187:Gria1 UTSW 11 57238110 missense possibly damaging 0.84
R6262:Gria1 UTSW 11 57242854 missense probably damaging 1.00
R6828:Gria1 UTSW 11 57289462 missense probably damaging 1.00
R7374:Gria1 UTSW 11 57189808 missense probably benign
R7507:Gria1 UTSW 11 57228939 missense probably benign 0.14
R7511:Gria1 UTSW 11 57283625 missense probably damaging 1.00
R7691:Gria1 UTSW 11 57236987 missense possibly damaging 0.94
R7898:Gria1 UTSW 11 57242765 missense probably damaging 1.00
R7981:Gria1 UTSW 11 57242765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACACAGGGAGCAGTAACTTCAC -3'
(R):5'- TTTTAGCACCCACAGCAGCAGC -3'

Sequencing Primer
(F):5'- GGAGCAGTAACTTCACTTGCTAC -3'
(R):5'- GCAGCACACCCATCTCCTC -3'
Posted On2013-06-12