Incidental Mutation 'R4796:Itga1'
ID 472715
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Name integrin alpha 1
Synonyms E130012M19Rik, CD49A, Vla1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R4796 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 115094615-115238500 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115171921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Cysteine at position 61 (W61C)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673] [ENSMUST00000224495]
AlphaFold Q3V3R4
Predicted Effect probably damaging
Transcript: ENSMUST00000061673
AA Change: W61C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: W61C

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224493
Predicted Effect probably benign
Transcript: ENSMUST00000224495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Meta Mutation Damage Score 0.5109 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Igsf8 T C 1: 172,143,889 (GRCm39) V14A probably benign Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Itgb5 T C 16: 33,705,391 (GRCm39) V227A possibly damaging Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mrtfa C T 15: 80,901,234 (GRCm39) S419N probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Polk T C 13: 96,625,764 (GRCm39) T347A probably benign Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Prex1 A T 2: 166,434,211 (GRCm39) L503Q probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Vmn2r76 T C 7: 85,879,652 (GRCm39) D216G possibly damaging Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 115,128,899 (GRCm39) missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115,167,729 (GRCm39) missense probably benign 0.00
IGL00549:Itga1 APN 13 115,185,832 (GRCm39) missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115,148,785 (GRCm39) missense probably damaging 1.00
IGL01021:Itga1 APN 13 115,133,536 (GRCm39) missense probably benign 0.29
IGL01289:Itga1 APN 13 115,122,762 (GRCm39) missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115,143,484 (GRCm39) missense possibly damaging 0.73
IGL01791:Itga1 APN 13 115,124,197 (GRCm39) missense probably benign 0.00
IGL01796:Itga1 APN 13 115,121,657 (GRCm39) missense probably damaging 1.00
IGL02027:Itga1 APN 13 115,126,591 (GRCm39) splice site probably null
IGL02330:Itga1 APN 13 115,148,740 (GRCm39) missense probably damaging 1.00
IGL02480:Itga1 APN 13 115,124,184 (GRCm39) missense probably damaging 1.00
IGL02943:Itga1 APN 13 115,185,832 (GRCm39) missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115,152,790 (GRCm39) missense probably benign 0.40
R0103:Itga1 UTSW 13 115,152,790 (GRCm39) missense probably benign 0.40
R0244:Itga1 UTSW 13 115,143,433 (GRCm39) splice site probably benign
R0265:Itga1 UTSW 13 115,128,995 (GRCm39) missense probably benign
R0302:Itga1 UTSW 13 115,148,854 (GRCm39) splice site probably benign
R0320:Itga1 UTSW 13 115,114,130 (GRCm39) splice site probably benign
R0389:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R0443:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R0574:Itga1 UTSW 13 115,103,097 (GRCm39) missense probably damaging 1.00
R0646:Itga1 UTSW 13 115,104,835 (GRCm39) missense probably benign
R0830:Itga1 UTSW 13 115,143,568 (GRCm39) missense probably benign 0.08
R2162:Itga1 UTSW 13 115,167,446 (GRCm39) missense probably benign 0.23
R2216:Itga1 UTSW 13 115,133,565 (GRCm39) missense probably benign 0.00
R2403:Itga1 UTSW 13 115,114,150 (GRCm39) missense probably benign 0.00
R3734:Itga1 UTSW 13 115,114,175 (GRCm39) missense probably benign
R4171:Itga1 UTSW 13 115,167,422 (GRCm39) nonsense probably null
R4402:Itga1 UTSW 13 115,138,102 (GRCm39) missense probably benign 0.00
R4675:Itga1 UTSW 13 115,138,227 (GRCm39) splice site probably null
R4684:Itga1 UTSW 13 115,185,906 (GRCm39) missense probably damaging 1.00
R4795:Itga1 UTSW 13 115,171,921 (GRCm39) missense probably damaging 1.00
R4845:Itga1 UTSW 13 115,110,708 (GRCm39) nonsense probably null
R5147:Itga1 UTSW 13 115,121,678 (GRCm39) missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115,171,839 (GRCm39) missense probably benign
R5234:Itga1 UTSW 13 115,185,839 (GRCm39) nonsense probably null
R5344:Itga1 UTSW 13 115,138,845 (GRCm39) missense possibly damaging 0.78
R5554:Itga1 UTSW 13 115,129,010 (GRCm39) nonsense probably null
R5662:Itga1 UTSW 13 115,122,707 (GRCm39) missense probably benign 0.03
R5945:Itga1 UTSW 13 115,103,126 (GRCm39) missense probably benign 0.02
R6150:Itga1 UTSW 13 115,104,769 (GRCm39) missense probably benign 0.01
R6241:Itga1 UTSW 13 115,096,673 (GRCm39) splice site probably null
R6276:Itga1 UTSW 13 115,117,388 (GRCm39) missense probably benign
R6369:Itga1 UTSW 13 115,102,196 (GRCm39) missense probably damaging 1.00
R6511:Itga1 UTSW 13 115,129,037 (GRCm39) missense probably damaging 0.98
R6663:Itga1 UTSW 13 115,110,641 (GRCm39) missense probably benign 0.02
R6783:Itga1 UTSW 13 115,133,513 (GRCm39) missense probably benign 0.22
R6931:Itga1 UTSW 13 115,138,099 (GRCm39) missense probably benign 0.39
R7069:Itga1 UTSW 13 115,104,776 (GRCm39) missense probably damaging 1.00
R7458:Itga1 UTSW 13 115,122,802 (GRCm39) missense probably benign 0.00
R7588:Itga1 UTSW 13 115,104,785 (GRCm39) missense possibly damaging 0.88
R7591:Itga1 UTSW 13 115,119,315 (GRCm39) missense probably damaging 1.00
R7597:Itga1 UTSW 13 115,110,676 (GRCm39) missense probably benign 0.28
R7615:Itga1 UTSW 13 115,133,458 (GRCm39) missense probably null 0.99
R7756:Itga1 UTSW 13 115,128,996 (GRCm39) missense probably benign 0.04
R7795:Itga1 UTSW 13 115,148,772 (GRCm39) missense probably damaging 1.00
R7819:Itga1 UTSW 13 115,185,837 (GRCm39) missense probably damaging 0.99
R8193:Itga1 UTSW 13 115,104,991 (GRCm39) critical splice donor site probably null
R8313:Itga1 UTSW 13 115,103,120 (GRCm39) missense probably benign 0.06
R8419:Itga1 UTSW 13 115,143,604 (GRCm39) missense probably damaging 1.00
R8925:Itga1 UTSW 13 115,105,055 (GRCm39) missense probably benign 0.01
R8927:Itga1 UTSW 13 115,105,055 (GRCm39) missense probably benign 0.01
R8951:Itga1 UTSW 13 115,107,027 (GRCm39) nonsense probably null
R9099:Itga1 UTSW 13 115,185,856 (GRCm39) missense probably damaging 1.00
R9200:Itga1 UTSW 13 115,104,997 (GRCm39) missense possibly damaging 0.80
R9221:Itga1 UTSW 13 115,166,695 (GRCm39) nonsense probably null
R9249:Itga1 UTSW 13 115,185,834 (GRCm39) missense probably damaging 1.00
R9267:Itga1 UTSW 13 115,185,924 (GRCm39) missense possibly damaging 0.50
R9376:Itga1 UTSW 13 115,107,112 (GRCm39) missense probably benign 0.07
R9481:Itga1 UTSW 13 115,152,753 (GRCm39) missense probably benign 0.34
R9789:Itga1 UTSW 13 115,171,820 (GRCm39) nonsense probably null
Z1177:Itga1 UTSW 13 115,121,607 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGAAAGTTGTTTGCAGTG -3'
(R):5'- ATGATAGCCATACTGATTGCTGAG -3'

Sequencing Primer
(F):5'- TTTGCAGTGAGAATATGGGCAC -3'
(R):5'- TGAGATTTACAGCAGCACTAGC -3'
Posted On 2017-04-14