Mutagenetix > Incidental Mutation

Incidental Mutation 'R4796:Igf2r'

472716

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R4796 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12684126 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 2346 (V2346I)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024599
AA Change: V2346I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: V2346I

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	A	G	2: 148,850,738	F48S	probably damaging	Het
9930021J03Rik	G	A	19: 29,753,618	H665Y	probably benign	Het
Adgrv1	C	T	13: 81,155,231	W132*	probably null	Het
Atp8b3	A	G	10: 80,524,354	V961A	probably damaging	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Bmp1	T	C	14: 70,492,073		probably null	Het
Btaf1	T	C	19: 36,956,428	L152P	possibly damaging	Het
Cacna1b	T	A	2: 24,637,487	T1621S	possibly damaging	Het
Capn3	A	T	2: 120,502,998	N621I	probably damaging	Het
Ccdc59	T	C	10: 105,841,568	S23P	probably benign	Het
Cd22	A	T	7: 30,872,956		probably null	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Cep112	T	C	11: 108,486,992		probably null	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Coq10b	A	G	1: 55,071,798	T242A	probably damaging	Het
Ctnnd1	G	T	2: 84,619,926	R317S	probably damaging	Het
Dlg5	G	A	14: 24,144,383	H1674Y	probably damaging	Het
Drc3	C	A	11: 60,363,528	N75K	probably damaging	Het
Efna4	T	C	3: 89,335,248	E113G	probably damaging	Het
Egr3	C	A	14: 70,077,575	A44D	probably benign	Het
Ercc3	T	C	18: 32,248,310	F393S	probably damaging	Het
Evi2	T	A	11: 79,515,447		probably benign	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Farsb	A	T	1: 78,425,196	*590R	probably null	Het
Fat3	A	G	9: 15,999,732	M1658T	probably benign	Het
Fhod3	G	T	18: 24,985,301	V232F	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fzd3	A	G	14: 65,235,158	V387A	possibly damaging	Het
Gm14085	T	A	2: 122,514,459	I182N	probably damaging	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Gm7964	A	G	7: 83,755,901		probably null	Het
Hbs1l	G	T	10: 21,342,506	G301C	probably damaging	Het
Hipk4	A	G	7: 27,528,570	H247R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hoxa5	C	T	6: 52,203,963	A130T	probably benign	Het
Igsf8	T	C	1: 172,316,322	V14A	probably benign	Het
Impg1	G	A	9: 80,394,095	P183L	probably damaging	Het
Isl1	T	C	13: 116,305,430	N89S	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Itgb5	T	C	16: 33,885,021	V227A	possibly damaging	Het
Jph4	G	T	14: 55,109,708	P461T	probably damaging	Het
Kcnab1	T	A	3: 65,304,165		probably null	Het
Klrc1	T	A	6: 129,677,762		probably null	Het
Lonrf2	A	T	1: 38,816,038	L92Q	probably benign	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Mapk13	T	C	17: 28,775,554	Y140H	probably damaging	Het
Mgat4d	A	G	8: 83,358,120	E164G	probably damaging	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mthfs	A	T	9: 89,240,025	H188L	probably benign	Het
Muc5b	T	A	7: 141,864,246	M3643K	possibly damaging	Het
Mylk3	T	C	8: 85,350,385	Y474C	probably damaging	Het
Myo5b	A	G	18: 74,744,630	T1567A	possibly damaging	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nxph2	C	T	2: 23,399,858	T74M	probably benign	Het
Ogdh	T	A	11: 6,340,570	M385K	probably benign	Het
Olfr1239	T	C	2: 89,417,891	H174R	probably damaging	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr402	A	T	11: 74,155,591	I146F	probably benign	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr830	T	C	9: 18,876,179	V284A	probably damaging	Het
Olfr921	T	A	9: 38,775,374	F40I	probably benign	Het
Pcsk2	A	C	2: 143,813,425	I510L	probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pex26	T	C	6: 121,193,557	F287S	probably damaging	Het
Pick1	G	C	15: 79,255,610		probably benign	Het
Plxnb1	G	T	9: 109,114,595	V1917L	probably damaging	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp1r10	T	G	17: 35,924,087	I61R	probably damaging	Het
Prex1	A	T	2: 166,592,291	L503Q	probably damaging	Het
Ptp4a1	A	C	1: 30,943,938	I133R	probably damaging	Het
Rassf10	G	T	7: 112,954,528	R112L	probably damaging	Het
Ripor3	T	A	2: 167,981,340	I884F	probably damaging	Het
Rnft2	A	G	5: 118,201,246	Y369H	probably damaging	Het
Rtp3	A	T	9: 110,986,454	V281E	probably benign	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Sgca	A	T	11: 94,970,727		probably null	Het
Slc22a3	T	C	17: 12,423,788	E514G	probably damaging	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Smarcal1	G	A	1: 72,597,440	V425I	probably benign	Het
Soga1	A	G	2: 157,020,252	S1586P	probably benign	Het
Ssx2ip	T	C	3: 146,418,359	V43A	probably benign	Het
Synpo	A	G	18: 60,604,314	S187P	probably damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tldc1	A	T	8: 119,768,354	S222T	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Upk1b	T	C	16: 38,787,242	H41R	probably benign	Het
Vmn2r76	T	C	7: 86,230,444	D216G	possibly damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zfp383	A	C	7: 29,914,838	T173P	possibly damaging	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTCACCTCTGGAACGGTCAG -3'
(R):5'- AACAGTCATGAGCCCTGTCAG -3'

Sequencing Primer
(F):5'- GGACCTCATCCTCACTGTCCTG -3'
(R):5'- ATGAGCCCTGTCAGGTCCTG -3'

Posted On

2017-04-14