Incidental Mutation 'R0503:Mrps27'
ID47276
Institutional Source Beutler Lab
Gene Symbol Mrps27
Ensembl Gene ENSMUSG00000041632
Gene Namemitochondrial ribosomal protein S27
Synonyms2610028H14Rik
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location99344786-99415562 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 99409795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052249] [ENSMUST00000224660]
Predicted Effect probably benign
Transcript: ENSMUST00000052249
SMART Domains Protein: ENSMUSP00000062326
Gene: ENSMUSG00000041632

DomainStartEndE-ValueType
Pfam:MRP-S27 1 413 8.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180808
Predicted Effect probably benign
Transcript: ENSMUST00000224660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225937
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Mrps27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Mrps27 APN 13 99409816 missense probably damaging 1.00
IGL01685:Mrps27 APN 13 99414920 missense possibly damaging 0.52
P0043:Mrps27 UTSW 13 99412246 missense probably benign
R0122:Mrps27 UTSW 13 99365228 missense probably benign 0.13
R0502:Mrps27 UTSW 13 99409795 splice site probably benign
R0611:Mrps27 UTSW 13 99405074 missense probably damaging 1.00
R1540:Mrps27 UTSW 13 99405050 missense probably benign 0.17
R2566:Mrps27 UTSW 13 99400328 nonsense probably null
R4227:Mrps27 UTSW 13 99411340 missense probably damaging 1.00
R4235:Mrps27 UTSW 13 99405041 missense probably damaging 1.00
R4715:Mrps27 UTSW 13 99414815 unclassified probably null
R4761:Mrps27 UTSW 13 99412231 missense probably benign 0.10
R5114:Mrps27 UTSW 13 99411465 unclassified probably benign
R5294:Mrps27 UTSW 13 99409873 missense probably damaging 1.00
R6241:Mrps27 UTSW 13 99412246 missense probably benign
R6387:Mrps27 UTSW 13 99400317 missense possibly damaging 0.80
R6491:Mrps27 UTSW 13 99363030 missense probably damaging 1.00
R6992:Mrps27 UTSW 13 99405014 missense probably benign 0.16
R7165:Mrps27 UTSW 13 99414799 missense possibly damaging 0.89
R7241:Mrps27 UTSW 13 99411280 nonsense probably null
R7709:Mrps27 UTSW 13 99404996 missense probably benign 0.21
R7720:Mrps27 UTSW 13 99401330 missense unknown
Z1177:Mrps27 UTSW 13 99414843 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AATCTCACCACCCAGGAGTCCTTAG -3'
(R):5'- ACCACAAGTTCACATATGCTGTCCC -3'

Sequencing Primer
(F):5'- cccaggagtccttagttatatagag -3'
(R):5'- CTTGACCATCCATAACTGGAGTG -3'
Posted On2013-06-12