Incidental Mutation 'R0504:Kdm5b'
ID 47286
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 038699-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R0504 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 134548761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191572
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,128,057 (GRCm39) probably benign Het
Adamts6 T C 13: 104,563,438 (GRCm39) probably benign Het
Adamts9 T A 6: 92,889,626 (GRCm39) Y316F probably damaging Het
Agl A T 3: 116,580,433 (GRCm39) F374I probably damaging Het
Akr1c19 A G 13: 4,286,250 (GRCm39) T83A possibly damaging Het
Ankrd36 T A 11: 5,579,274 (GRCm39) S179R probably damaging Het
Appbp2 A G 11: 85,082,513 (GRCm39) S573P probably benign Het
Arid4a T A 12: 71,093,988 (GRCm39) F254I probably damaging Het
Bin3 T C 14: 70,361,336 (GRCm39) probably null Het
Bmi1 T C 2: 18,688,883 (GRCm39) probably null Het
Bmper G T 9: 23,317,983 (GRCm39) C534F probably damaging Het
Bora T A 14: 99,299,059 (GRCm39) C205* probably null Het
Btnl2 A G 17: 34,577,091 (GRCm39) E82G probably benign Het
Ccdc8 A T 7: 16,729,939 (GRCm39) D476V unknown Het
Ccr3 C A 9: 123,829,478 (GRCm39) T271K possibly damaging Het
Cd276 A G 9: 58,447,961 (GRCm39) L23P possibly damaging Het
Cd3e T C 9: 44,913,552 (GRCm39) Q61R probably benign Het
Cep97 A G 16: 55,726,142 (GRCm39) S582P probably benign Het
Chml A T 1: 175,514,748 (GRCm39) M391K probably damaging Het
Chst1 A G 2: 92,444,169 (GRCm39) N214D probably benign Het
Chuk T C 19: 44,070,377 (GRCm39) probably benign Het
Col12a1 G A 9: 79,588,750 (GRCm39) H1122Y possibly damaging Het
Cpne6 A G 14: 55,752,059 (GRCm39) K272R probably damaging Het
Cpsf2 T A 12: 101,956,262 (GRCm39) L355Q probably damaging Het
Cyp2c29 T A 19: 39,298,224 (GRCm39) D256E probably benign Het
Daglb G A 5: 143,479,952 (GRCm39) V420I probably benign Het
Ddx42 G T 11: 106,138,675 (GRCm39) G825C probably benign Het
Dis3 T C 14: 99,318,826 (GRCm39) probably benign Het
Dkk4 C T 8: 23,115,359 (GRCm39) R70C probably damaging Het
Dock6 G T 9: 21,713,732 (GRCm39) Q1933K probably damaging Het
Dpep2 T G 8: 106,716,620 (GRCm39) Q186H probably benign Het
Dzip3 A C 16: 48,780,006 (GRCm39) probably benign Het
Egflam T A 15: 7,252,239 (GRCm39) I853F probably damaging Het
Fastkd5 A G 2: 130,457,837 (GRCm39) I251T probably benign Het
Fbn2 T A 18: 58,172,532 (GRCm39) D2091V possibly damaging Het
Fem1al T C 11: 29,774,990 (GRCm39) I156V probably damaging Het
Fer1l4 C A 2: 155,894,115 (GRCm39) V63L probably benign Het
Frem1 T A 4: 82,830,874 (GRCm39) D2062V probably benign Het
Galnt6 A C 15: 100,594,538 (GRCm39) probably benign Het
Get3 A C 8: 85,745,236 (GRCm39) V277G probably damaging Het
Gm10972 A T 3: 94,550,440 (GRCm39) probably benign Het
Gm4846 G A 1: 166,319,114 (GRCm39) T208I probably benign Het
Gorab A G 1: 163,214,174 (GRCm39) L252P probably damaging Het
Gtsf2 A G 15: 103,352,988 (GRCm39) C63R probably damaging Het
Hal T C 10: 93,325,036 (GRCm39) V15A probably damaging Het
Hmcn1 A T 1: 150,752,170 (GRCm39) probably benign Het
Hormad2 A T 11: 4,358,833 (GRCm39) H191Q possibly damaging Het
Hspa2 A T 12: 76,451,990 (GRCm39) D228V probably damaging Het
Igfn1 A T 1: 135,896,267 (GRCm39) M1433K probably benign Het
Il18 A G 9: 50,486,628 (GRCm39) D19G probably damaging Het
Il1rl2 G A 1: 40,368,216 (GRCm39) V129I probably benign Het
Inpp5b C A 4: 124,676,201 (GRCm39) Y352* probably null Het
Insrr A T 3: 87,720,463 (GRCm39) M1034L possibly damaging Het
Jmjd1c T C 10: 67,061,534 (GRCm39) S1296P probably damaging Het
Krba1 C T 6: 48,393,188 (GRCm39) T998I probably benign Het
L3mbtl4 A G 17: 69,084,907 (GRCm39) N606S probably benign Het
Lonrf1 T A 8: 36,698,313 (GRCm39) N395I possibly damaging Het
Lpp A G 16: 24,790,720 (GRCm39) D393G probably damaging Het
Lrrc17 A G 5: 21,765,528 (GRCm39) I3M probably benign Het
Lrrtm4 A T 6: 79,999,029 (GRCm39) Q147L probably damaging Het
Map1a A G 2: 121,133,422 (GRCm39) M1413V probably benign Het
Mapk8ip2 A G 15: 89,340,861 (GRCm39) E102G possibly damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mdn1 T C 4: 32,698,916 (GRCm39) probably benign Het
Mfng A C 15: 78,641,514 (GRCm39) H294Q probably benign Het
Mical2 T A 7: 111,870,524 (GRCm39) N4K probably benign Het
Mov10l1 T A 15: 88,883,042 (GRCm39) V384E probably damaging Het
Myo18b A G 5: 113,021,442 (GRCm39) probably benign Het
Nlrp1b T G 11: 71,073,241 (GRCm39) I201L probably damaging Het
Nos2 C T 11: 78,830,903 (GRCm39) P249L probably damaging Het
Notch4 A G 17: 34,794,065 (GRCm39) T681A probably damaging Het
Nr1i3 C T 1: 171,044,805 (GRCm39) probably benign Het
Obscn A G 11: 58,899,333 (GRCm39) probably null Het
Onecut2 A T 18: 64,473,820 (GRCm39) I124F possibly damaging Het
Or10a49 C T 7: 108,468,057 (GRCm39) M101I possibly damaging Het
Or2a14 A T 6: 43,130,395 (GRCm39) H52L probably benign Het
Or2ag1 T A 7: 106,313,908 (GRCm39) probably benign Het
Or2f2 C T 6: 42,767,530 (GRCm39) R186* probably null Het
Or2t47 C A 11: 58,442,462 (GRCm39) C201F probably damaging Het
Or4a75 A T 2: 89,448,438 (GRCm39) Y33N probably damaging Het
Or4c123 C T 2: 89,127,083 (GRCm39) C177Y probably damaging Het
Or52u1 C T 7: 104,237,682 (GRCm39) R224* probably null Het
Or5m12 T A 2: 85,735,030 (GRCm39) M123L possibly damaging Het
Or8b35 A G 9: 37,904,438 (GRCm39) T217A probably benign Het
Otol1 G A 3: 69,934,937 (GRCm39) G310R probably damaging Het
Oxct2b T A 4: 123,010,633 (GRCm39) S184R possibly damaging Het
Oxct2b ACTG A 4: 123,010,705 (GRCm39) probably benign Het
P2rx6 A G 16: 17,385,291 (GRCm39) probably benign Het
Pde4a A G 9: 21,115,699 (GRCm39) N411S probably damaging Het
Phkb A T 8: 86,783,153 (GRCm39) D983V probably benign Het
Piezo2 G A 18: 63,157,522 (GRCm39) T2396I probably damaging Het
Pik3ap1 T A 19: 41,275,929 (GRCm39) D717V probably damaging Het
Plce1 T A 19: 38,766,465 (GRCm39) probably benign Het
Plekhg1 A G 10: 3,887,853 (GRCm39) I261V probably damaging Het
Ppfia4 T C 1: 134,251,851 (GRCm39) H441R probably damaging Het
Prpf8 T A 11: 75,392,768 (GRCm39) probably benign Het
Ptn T A 6: 36,718,388 (GRCm39) probably benign Het
Ptpn13 A G 5: 103,649,362 (GRCm39) Y255C possibly damaging Het
Ptpn4 A G 1: 119,693,645 (GRCm39) Y126H probably damaging Het
Ptprc T C 1: 138,016,435 (GRCm39) N505D probably damaging Het
Ptprs T A 17: 56,761,220 (GRCm39) I116F possibly damaging Het
Rab1a T G 11: 20,173,169 (GRCm39) V90G probably damaging Het
Rcor1 T C 12: 111,068,102 (GRCm39) V267A probably benign Het
Reep4 A G 14: 70,784,678 (GRCm39) probably null Het
Rere T A 4: 150,699,779 (GRCm39) probably benign Het
Rin3 T A 12: 102,353,823 (GRCm39) Y743* probably null Het
Rprm A G 2: 53,975,067 (GRCm39) S84P probably damaging Het
Sdhaf2 C T 19: 10,494,383 (GRCm39) E109K probably damaging Het
Sec31b G T 19: 44,523,225 (GRCm39) Q24K probably damaging Het
Sema5a T C 15: 32,574,949 (GRCm39) probably benign Het
Sh3pxd2a T C 19: 47,256,186 (GRCm39) Y844C probably damaging Het
Shmt2 A C 10: 127,355,941 (GRCm39) N134K probably damaging Het
Slc9a8 C T 2: 167,266,125 (GRCm39) A34V probably benign Het
Spidr A C 16: 15,957,936 (GRCm39) S64A possibly damaging Het
Stk10 A G 11: 32,567,882 (GRCm39) T895A probably benign Het
Syne2 A T 12: 76,080,365 (GRCm39) probably benign Het
Szt2 T C 4: 118,230,149 (GRCm39) probably null Het
Tecpr1 A T 5: 144,150,899 (GRCm39) V303D probably damaging Het
Tet3 A G 6: 83,350,776 (GRCm39) Y1048H probably damaging Het
Tfb2m A G 1: 179,373,396 (GRCm39) C101R probably damaging Het
Tg T C 15: 66,554,253 (GRCm39) V556A probably damaging Het
Thbs4 A C 13: 92,903,692 (GRCm39) I441M probably benign Het
Thsd7a A T 6: 12,379,593 (GRCm39) Y944N probably damaging Het
Tm9sf3 C A 19: 41,236,331 (GRCm39) probably benign Het
Tmem145 T C 7: 25,010,787 (GRCm39) F359S probably damaging Het
Ttc21b C T 2: 66,053,142 (GRCm39) probably benign Het
Ttn A G 2: 76,579,880 (GRCm39) V23671A probably damaging Het
Txnl4b T C 8: 110,298,103 (GRCm39) I78T probably benign Het
Ubr4 C A 4: 139,133,889 (GRCm39) L762I probably damaging Het
Ubr4 T C 4: 139,208,149 (GRCm39) probably null Het
Ugt1a8 C T 1: 88,016,079 (GRCm39) P164L probably damaging Het
Unc13b T C 4: 43,263,559 (GRCm39) S1594P probably damaging Het
Utrn A T 10: 12,278,639 (GRCm39) F912I probably benign Het
Vat1l T C 8: 114,963,319 (GRCm39) probably benign Het
Vmn1r50 T A 6: 90,084,863 (GRCm39) S203T probably damaging Het
Vmn2r4 A T 3: 64,296,784 (GRCm39) L667Q probably damaging Het
Vmn2r66 T G 7: 84,656,023 (GRCm39) Q331P probably damaging Het
Wdsub1 A T 2: 59,708,669 (GRCm39) V68D possibly damaging Het
Wnk2 C G 13: 49,238,870 (GRCm39) A564P possibly damaging Het
Wnk2 T A 13: 49,238,872 (GRCm39) K563M probably damaging Het
Zan T A 5: 137,468,580 (GRCm39) H297L probably damaging Het
Zfp426 A T 9: 20,381,327 (GRCm39) H539Q probably damaging Het
Zfp488 T A 14: 33,692,497 (GRCm39) N222I probably damaging Het
Zfp536 T A 7: 37,268,243 (GRCm39) H391L probably damaging Het
Zp1 T A 19: 10,893,571 (GRCm39) N31I probably damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGACGTGTGCCAGTGTTAGAGAC -3'
(R):5'- ACCTGCAAGCCCTGAACTGAAG -3'

Sequencing Primer
(F):5'- CCAGTGTTAGAGACACTCATTGAAC -3'
(R):5'- CCTGAGAACAGAGAGACTTATCTTAC -3'
Posted On 2013-06-12