Mutagenetix > Incidental Mutation

Incidental Mutation 'R3762:Cad'

473351

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

2410008J01Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R3762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31212124-31235823 bp(+) (GRCm39)

Type of Mutation

splice site (25 bp from exon)

DNA Base Change (assembly)

T to A at 31232890 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202973] [ENSMUST00000202795]

AlphaFold

B2RQC6

Predicted Effect

probably benign
Transcript: ENSMUST00000013773

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200917

Predicted Effect

probably benign
Transcript: ENSMUST00000200953

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201182

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201870

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202391

Predicted Effect

probably null
Transcript: ENSMUST00000202973

SMART Domains

Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
SCOP:d1gkra1	1	84	4e-28	SMART
PDB:4C6N\|A	1	119	4e-58	PDB
low complexity region	156	170	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202827

Predicted Effect

probably benign
Transcript: ENSMUST00000202795

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap35	A	T	7: 16,299,000 (GRCm39)	S22T	probably damaging	Het
Atp2b1	T	C	10: 98,845,351 (GRCm39)	I718T	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,619,782 (GRCm39)		probably benign	Het
Defa41	C	T	8: 21,691,753 (GRCm39)	S45F	probably damaging	Het
Dhx15	G	A	5: 52,324,074 (GRCm39)	P406L	probably benign	Het
Dnah17	T	A	11: 117,995,352 (GRCm39)	M999L	probably benign	Het
Dpysl4	A	G	7: 138,676,672 (GRCm39)	E374G	probably damaging	Het
Gatad2a	T	C	8: 70,368,930 (GRCm39)		probably null	Het
Gm826	C	A	2: 160,155,423 (GRCm39)		probably benign	Het
H2-M10.1	T	A	17: 36,636,216 (GRCm39)	H117L	probably damaging	Het
Klhl9	A	T	4: 88,639,830 (GRCm39)	V137D	possibly damaging	Het
Limch1	A	G	5: 67,186,183 (GRCm39)	Y828C	probably damaging	Het
Med1	T	C	11: 98,046,341 (GRCm39)		probably benign	Het
Muc5ac	A	T	7: 141,361,212 (GRCm39)	T1507S	possibly damaging	Het
Pak6	A	T	2: 118,526,958 (GRCm39)	Q651L	probably damaging	Het
Plscr2	T	A	9: 92,173,133 (GRCm39)	V90D	probably damaging	Het
Rbbp4	G	A	4: 129,228,344 (GRCm39)	T2I	probably damaging	Het
Rnf121	G	A	7: 101,673,244 (GRCm39)	T223M	probably damaging	Het
Rsph6a	A	G	7: 18,789,256 (GRCm39)	K196R	probably damaging	Het
Tex47	A	T	5: 7,355,529 (GRCm39)	I237L	probably benign	Het
Ulk1	C	T	5: 110,937,223 (GRCm39)	R691Q	probably benign	Het
Vmn1r30	C	A	6: 58,412,278 (GRCm39)	V185L	probably benign	Het
Vmn2r103	A	T	17: 20,032,411 (GRCm39)	E728D	probably damaging	Het
Vmn2r14	A	T	5: 109,368,033 (GRCm39)	Y320N	probably benign	Het
Zc3h14	T	A	12: 98,724,902 (GRCm39)	F188Y	probably damaging	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31,218,828 (GRCm39)	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31,216,398 (GRCm39)	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31,219,114 (GRCm39)	splice site	probably benign
IGL01638:Cad	APN	5	31,224,958 (GRCm39)	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31,218,170 (GRCm39)	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31,226,948 (GRCm39)	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31,212,638 (GRCm39)	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31,212,330 (GRCm39)	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31,229,438 (GRCm39)	missense	probably damaging	0.99
R0212:Cad	UTSW	5	31,235,454 (GRCm39)	missense	probably damaging	1.00
R0317:Cad	UTSW	5	31,229,665 (GRCm39)	missense	probably benign	0.01
R0335:Cad	UTSW	5	31,231,329 (GRCm39)	unclassified	probably benign
R0401:Cad	UTSW	5	31,231,330 (GRCm39)	unclassified	probably benign
R0445:Cad	UTSW	5	31,230,053 (GRCm39)	missense	probably benign	0.08
R0494:Cad	UTSW	5	31,234,856 (GRCm39)	unclassified	probably benign
R0532:Cad	UTSW	5	31,219,531 (GRCm39)	splice site	probably benign
R0539:Cad	UTSW	5	31,232,801 (GRCm39)	splice site	probably benign
R0578:Cad	UTSW	5	31,216,120 (GRCm39)	missense	probably benign	0.01
R0590:Cad	UTSW	5	31,219,575 (GRCm39)	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31,235,032 (GRCm39)	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31,224,944 (GRCm39)	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31,216,926 (GRCm39)	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31,226,106 (GRCm39)	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31,233,563 (GRCm39)	missense	probably benign	0.14
R1763:Cad	UTSW	5	31,218,295 (GRCm39)	missense	probably damaging	1.00
R1785:Cad	UTSW	5	31,215,416 (GRCm39)	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31,215,416 (GRCm39)	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31,215,416 (GRCm39)	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31,219,564 (GRCm39)	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31,219,018 (GRCm39)	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31,231,481 (GRCm39)	missense	possibly damaging	0.50
R3847:Cad	UTSW	5	31,218,994 (GRCm39)	missense	probably damaging	1.00
R3898:Cad	UTSW	5	31,231,366 (GRCm39)	missense	probably benign	0.06
R3943:Cad	UTSW	5	31,229,729 (GRCm39)	critical splice donor site	probably null
R4213:Cad	UTSW	5	31,229,688 (GRCm39)	missense	probably benign	0.01
R4458:Cad	UTSW	5	31,218,570 (GRCm39)	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31,215,477 (GRCm39)	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31,227,639 (GRCm39)	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31,224,030 (GRCm39)	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31,232,034 (GRCm39)	missense	probably benign	0.02
R5044:Cad	UTSW	5	31,212,365 (GRCm39)	missense	probably benign	0.00
R5630:Cad	UTSW	5	31,217,917 (GRCm39)	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31,234,191 (GRCm39)	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31,226,456 (GRCm39)	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31,212,327 (GRCm39)	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31,219,906 (GRCm39)	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31,230,322 (GRCm39)	missense	probably benign	0.00
R6260:Cad	UTSW	5	31,224,144 (GRCm39)	missense	probably null
R7145:Cad	UTSW	5	31,224,956 (GRCm39)	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31,217,557 (GRCm39)	critical splice donor site	probably null
R7352:Cad	UTSW	5	31,215,422 (GRCm39)	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31,233,173 (GRCm39)	missense	probably benign
R7387:Cad	UTSW	5	31,219,284 (GRCm39)	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31,231,506 (GRCm39)	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31,226,392 (GRCm39)	missense	probably benign
R7627:Cad	UTSW	5	31,217,508 (GRCm39)	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31,218,829 (GRCm39)	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31,226,150 (GRCm39)	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31,218,271 (GRCm39)	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31,233,165 (GRCm39)	missense	probably benign	0.00
R8523:Cad	UTSW	5	31,215,450 (GRCm39)	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31,232,500 (GRCm39)	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31,231,945 (GRCm39)	missense	probably benign	0.06
R8698:Cad	UTSW	5	31,234,819 (GRCm39)	missense	probably benign
R8699:Cad	UTSW	5	31,233,605 (GRCm39)	missense	possibly damaging	0.80
R8803:Cad	UTSW	5	31,226,908 (GRCm39)	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31,225,009 (GRCm39)	missense	probably null
R9272:Cad	UTSW	5	31,218,576 (GRCm39)	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31,230,000 (GRCm39)	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31,234,988 (GRCm39)	missense	probably damaging	1.00
R9609:Cad	UTSW	5	31,228,018 (GRCm39)	critical splice donor site	probably null
R9665:Cad	UTSW	5	31,229,703 (GRCm39)	missense	probably benign	0.28
RF001:Cad	UTSW	5	31,217,556 (GRCm39)	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31,217,556 (GRCm39)	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31,225,475 (GRCm39)	missense	probably null	1.00
X0022:Cad	UTSW	5	31,229,661 (GRCm39)	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31,232,472 (GRCm39)	missense	probably benign	0.25
Z1177:Cad	UTSW	5	31,225,765 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

Posted On

2017-04-14