Incidental Mutation 'R3731:Ighv1-19'
ID473417
Institutional Source Beutler Lab
Gene Symbol Ighv1-19
Ensembl Gene ENSMUSG00000096410
Gene Nameimmunoglobulin heavy variable V1-19
SynonymsGm16855
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location114708648-114709135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114708877 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 40 (C40F)
Ref Sequence ENSEMBL: ENSMUSP00000100286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103505] [ENSMUST00000193855]
Predicted Effect probably damaging
Transcript: ENSMUST00000103505
AA Change: C40F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100286
Gene: ENSMUSG00000096410
AA Change: C40F

DomainStartEndE-ValueType
IGv 35 116 8.41e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192823
Predicted Effect probably damaging
Transcript: ENSMUST00000193855
AA Change: C41F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141737
Gene: ENSMUSG00000096410
AA Change: C41F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.5e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Ighv1-19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ighv1-19 APN 12 114708709 missense probably benign 0.15
IGL00966:Ighv1-19 APN 12 114708949 missense possibly damaging 0.51
IGL02545:Ighv1-19 APN 12 114708739 missense probably damaging 1.00
R3729:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3730:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R4093:Ighv1-19 UTSW 12 114708730 missense probably damaging 1.00
R4969:Ighv1-19 UTSW 12 114708757 missense probably benign 0.12
R5021:Ighv1-19 UTSW 12 114709066 missense probably benign 0.00
R6448:Ighv1-19 UTSW 12 114708676 missense probably damaging 1.00
R7335:Ighv1-19 UTSW 12 114708951 critical splice acceptor site probably benign
R8364:Ighv1-19 UTSW 12 114708926 missense possibly damaging 0.91
Predicted Primers
Posted On2017-04-14