Mutagenetix > Incidental Mutation

Incidental Mutation 'R0504:Utrn'

47363

Institutional Source

Beutler Lab

Gene Symbol

Utrn

Ensembl Gene

ENSMUSG00000019820

Gene Name

utrophin

Synonyms

G-utrophin, DRP, Dmdl

MMRRC Submission

038699-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0504 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12382188-12869365 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12402895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 912 (F912I)

Ref Sequence

ENSEMBL: ENSMUSP00000151628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217994] [ENSMUST00000218635] [ENSMUST00000219003]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076817
AA Change: F3386I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: F3386I

Domain	Start	End	E-Value	Type
CH	33	133	1.87e-24	SMART
CH	152	250	4.05e-20	SMART
SPEC	312	416	2.31e-18	SMART
SPEC	421	525	4.18e-16	SMART
SPEC	532	636	3.35e-6	SMART
low complexity region	665	679	N/A	INTRINSIC
SPEC	690	795	1.7e-7	SMART
SPEC	801	901	1e-4	SMART
SPEC	910	1012	8.24e-2	SMART
SPEC	1019	1121	1.32e-4	SMART
SPEC	1128	1229	2.64e-4	SMART
SPEC	1236	1333	4.42e-6	SMART
coiled coil region	1375	1401	N/A	INTRINSIC
SPEC	1438	1540	3.62e-2	SMART
SPEC	1547	1648	7.95e-1	SMART
SPEC	1655	1752	3.56e0	SMART
coiled coil region	1766	1795	N/A	INTRINSIC
SPEC	1870	1972	3.63e0	SMART
SPEC	1979	2080	5.15e-16	SMART
SPEC	2087	2183	3.71e0	SMART
SPEC	2227	2330	4.7e-10	SMART
SPEC	2337	2437	1.02e0	SMART
SPEC	2444	2553	2.35e-10	SMART
SPEC	2560	2685	8.77e-10	SMART
SPEC	2692	2794	4.13e-6	SMART
WW	2811	2843	5.59e-7	SMART
Pfam:EF-hand_2	2844	2962	3.8e-41	PFAM
Pfam:EF-hand_3	2966	3057	1.6e-39	PFAM
ZnF_ZZ	3062	3107	6.33e-17	SMART
coiled coil region	3250	3289	N/A	INTRINSIC
coiled coil region	3310	3354	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217938

Predicted Effect

probably benign
Transcript: ENSMUST00000217994
AA Change: F943I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000218635
AA Change: F3386I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000219003
AA Change: F912I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

99% (145/147)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 145 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	G	4: 103,270,860		probably benign	Het
4931440F15Rik	T	C	11: 29,824,990	I156V	probably damaging	Het
Adamts6	T	C	13: 104,426,930		probably benign	Het
Adamts9	T	A	6: 92,912,645	Y316F	probably damaging	Het
Agl	A	T	3: 116,786,784	F374I	probably damaging	Het
Akr1c19	A	G	13: 4,236,251	T83A	possibly damaging	Het
Ankrd36	T	A	11: 5,629,274	S179R	probably damaging	Het
Appbp2	A	G	11: 85,191,687	S573P	probably benign	Het
Arid4a	T	A	12: 71,047,214	F254I	probably damaging	Het
Asna1	A	C	8: 85,018,607	V277G	probably damaging	Het
Bin3	T	C	14: 70,123,887		probably null	Het
Bmi1	T	C	2: 18,684,072		probably null	Het
Bmper	G	T	9: 23,406,687	C534F	probably damaging	Het
Bora	T	A	14: 99,061,623	C205*	probably null	Het
Btnl2	A	G	17: 34,358,117	E82G	probably benign	Het
Ccdc8	A	T	7: 16,996,014	D476V	unknown	Het
Ccr3	C	A	9: 124,029,441	T271K	possibly damaging	Het
Cd276	A	G	9: 58,540,678	L23P	possibly damaging	Het
Cd3e	T	C	9: 45,002,254	Q61R	probably benign	Het
Cep97	A	G	16: 55,905,779	S582P	probably benign	Het
Chml	A	T	1: 175,687,182	M391K	probably damaging	Het
Chst1	A	G	2: 92,613,824	N214D	probably benign	Het
Chuk	T	C	19: 44,081,938		probably benign	Het
Col12a1	G	A	9: 79,681,468	H1122Y	possibly damaging	Het
Cpne6	A	G	14: 55,514,602	K272R	probably damaging	Het
Cpsf2	T	A	12: 101,990,003	L355Q	probably damaging	Het
Cyp2c29	T	A	19: 39,309,780	D256E	probably benign	Het
Daglb	G	A	5: 143,494,197	V420I	probably benign	Het
Ddx42	G	T	11: 106,247,849	G825C	probably benign	Het
Dis3	T	C	14: 99,081,390		probably benign	Het
Dkk4	C	T	8: 22,625,343	R70C	probably damaging	Het
Dock6	G	T	9: 21,802,436	Q1933K	probably damaging	Het
Dpep2	T	G	8: 105,989,988	Q186H	probably benign	Het
Dzip3	A	C	16: 48,959,643		probably benign	Het
Egflam	T	A	15: 7,222,758	I853F	probably damaging	Het
Fastkd5	A	G	2: 130,615,917	I251T	probably benign	Het
Fbn2	T	A	18: 58,039,460	D2091V	possibly damaging	Het
Fer1l4	C	A	2: 156,052,195	V63L	probably benign	Het
Frem1	T	A	4: 82,912,637	D2062V	probably benign	Het
Galnt6	A	C	15: 100,696,657		probably benign	Het
Gm10972	A	T	3: 94,643,133		probably benign	Het
Gm4846	G	A	1: 166,491,545	T208I	probably benign	Het
Gorab	A	G	1: 163,386,605	L252P	probably damaging	Het
Gtsf2	A	G	15: 103,444,561	C63R	probably damaging	Het
Hal	T	C	10: 93,489,174	V15A	probably damaging	Het
Hmcn1	A	T	1: 150,876,419		probably benign	Het
Hormad2	A	T	11: 4,408,833	H191Q	possibly damaging	Het
Hspa2	A	T	12: 76,405,216	D228V	probably damaging	Het
Igfn1	A	T	1: 135,968,529	M1433K	probably benign	Het
Il18	A	G	9: 50,575,328	D19G	probably damaging	Het
Il1rl2	G	A	1: 40,329,056	V129I	probably benign	Het
Inpp5b	C	A	4: 124,782,408	Y352*	probably null	Het
Insrr	A	T	3: 87,813,156	M1034L	possibly damaging	Het
Jmjd1c	T	C	10: 67,225,755	S1296P	probably damaging	Het
Kdm5b	G	T	1: 134,621,023		probably null	Het
Krba1	C	T	6: 48,416,254	T998I	probably benign	Het
L3mbtl4	A	G	17: 68,777,912	N606S	probably benign	Het
Lonrf1	T	A	8: 36,231,159	N395I	possibly damaging	Het
Lpp	A	G	16: 24,971,970	D393G	probably damaging	Het
Lrrc17	A	G	5: 21,560,530	I3M	probably benign	Het
Lrrtm4	A	T	6: 80,022,046	Q147L	probably damaging	Het
Map1a	A	G	2: 121,302,941	M1413V	probably benign	Het
Mapk8ip2	A	G	15: 89,456,658	E102G	possibly damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mdn1	T	C	4: 32,698,916		probably benign	Het
Mfng	A	C	15: 78,757,314	H294Q	probably benign	Het
Mical2	T	A	7: 112,271,317	N4K	probably benign	Het
Mov10l1	T	A	15: 88,998,839	V384E	probably damaging	Het
Myo18b	A	G	5: 112,873,576		probably benign	Het
Nlrp1b	T	G	11: 71,182,415	I201L	probably damaging	Het
Nos2	C	T	11: 78,940,077	P249L	probably damaging	Het
Notch4	A	G	17: 34,575,091	T681A	probably damaging	Het
Nr1i3	C	T	1: 171,217,236		probably benign	Het
Obscn	A	G	11: 59,008,507		probably null	Het
Olfr1024	T	A	2: 85,904,686	M123L	possibly damaging	Het
Olfr1230	C	T	2: 89,296,739	C177Y	probably damaging	Het
Olfr1248	A	T	2: 89,618,094	Y33N	probably damaging	Het
Olfr237-ps1	A	T	6: 43,153,461	H52L	probably benign	Het
Olfr328	C	A	11: 58,551,636	C201F	probably damaging	Het
Olfr452	C	T	6: 42,790,596	R186*	probably null	Het
Olfr517	C	T	7: 108,868,850	M101I	possibly damaging	Het
Olfr654	C	T	7: 104,588,475	R224*	probably null	Het
Olfr705	T	A	7: 106,714,701		probably benign	Het
Olfr881	A	G	9: 37,993,142	T217A	probably benign	Het
Onecut2	A	T	18: 64,340,749	I124F	possibly damaging	Het
Otol1	G	A	3: 70,027,604	G310R	probably damaging	Het
Oxct2b	T	A	4: 123,116,840	S184R	possibly damaging	Het
Oxct2b	ACTG	A	4: 123,116,912		probably benign	Het
P2rx6	A	G	16: 17,567,427		probably benign	Het
Pde4a	A	G	9: 21,204,403	N411S	probably damaging	Het
Phkb	A	T	8: 86,056,524	D983V	probably benign	Het
Piezo2	G	A	18: 63,024,451	T2396I	probably damaging	Het
Pik3ap1	T	A	19: 41,287,490	D717V	probably damaging	Het
Plce1	T	A	19: 38,778,021		probably benign	Het
Plekhg1	A	G	10: 3,937,853	I261V	probably damaging	Het
Ppfia4	T	C	1: 134,324,113	H441R	probably damaging	Het
Prpf8	T	A	11: 75,501,942		probably benign	Het
Ptn	T	A	6: 36,741,453		probably benign	Het
Ptpn13	A	G	5: 103,501,496	Y255C	possibly damaging	Het
Ptpn4	A	G	1: 119,765,915	Y126H	probably damaging	Het
Ptprc	T	C	1: 138,088,697	N505D	probably damaging	Het
Ptprs	T	A	17: 56,454,220	I116F	possibly damaging	Het
Rab1a	T	G	11: 20,223,169	V90G	probably damaging	Het
Rcor1	T	C	12: 111,101,668	V267A	probably benign	Het
Reep4	A	G	14: 70,547,238		probably null	Het
Rere	T	A	4: 150,615,322		probably benign	Het
Rin3	T	A	12: 102,387,564	Y743*	probably null	Het
Rprm	A	G	2: 54,085,055	S84P	probably damaging	Het
Sdhaf2	C	T	19: 10,517,019	E109K	probably damaging	Het
Sec31b	G	T	19: 44,534,786	Q24K	probably damaging	Het
Sema5a	T	C	15: 32,574,803		probably benign	Het
Sh3pxd2a	T	C	19: 47,267,747	Y844C	probably damaging	Het
Shmt2	A	C	10: 127,520,072	N134K	probably damaging	Het
Slc9a8	C	T	2: 167,424,205	A34V	probably benign	Het
Spidr	A	C	16: 16,140,072	S64A	possibly damaging	Het
Stk10	A	G	11: 32,617,882	T895A	probably benign	Het
Syne2	A	T	12: 76,033,591		probably benign	Het
Szt2	T	C	4: 118,372,952		probably null	Het
Tecpr1	A	T	5: 144,214,081	V303D	probably damaging	Het
Tet3	A	G	6: 83,373,794	Y1048H	probably damaging	Het
Tfb2m	A	G	1: 179,545,831	C101R	probably damaging	Het
Tg	T	C	15: 66,682,404	V556A	probably damaging	Het
Thbs4	A	C	13: 92,767,184	I441M	probably benign	Het
Thsd7a	A	T	6: 12,379,594	Y944N	probably damaging	Het
Tm9sf3	C	A	19: 41,247,892		probably benign	Het
Tmem145	T	C	7: 25,311,362	F359S	probably damaging	Het
Ttc21b	C	T	2: 66,222,798		probably benign	Het
Ttn	A	G	2: 76,749,536	V23671A	probably damaging	Het
Txnl4b	T	C	8: 109,571,471	I78T	probably benign	Het
Ubr4	C	A	4: 139,406,578	L762I	probably damaging	Het
Ubr4	T	C	4: 139,480,838		probably null	Het
Ugt1a8	C	T	1: 88,088,357	P164L	probably damaging	Het
Unc13b	T	C	4: 43,263,559	S1594P	probably damaging	Het
Vat1l	T	C	8: 114,236,579		probably benign	Het
Vmn1r50	T	A	6: 90,107,881	S203T	probably damaging	Het
Vmn2r4	A	T	3: 64,389,363	L667Q	probably damaging	Het
Vmn2r66	T	G	7: 85,006,815	Q331P	probably damaging	Het
Wdsub1	A	T	2: 59,878,325	V68D	possibly damaging	Het
Wnk2	C	G	13: 49,085,394	A564P	possibly damaging	Het
Wnk2	T	A	13: 49,085,396	K563M	probably damaging	Het
Zan	T	A	5: 137,470,318	H297L	probably damaging	Het
Zfp426	A	T	9: 20,470,031	H539Q	probably damaging	Het
Zfp488	T	A	14: 33,970,540	N222I	probably damaging	Het
Zfp536	T	A	7: 37,568,818	H391L	probably damaging	Het
Zp1	T	A	19: 10,916,207	N31I	probably damaging	Het

Other mutations in Utrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Utrn	APN	10	12671830	missense	probably damaging	1.00
IGL00469:Utrn	APN	10	12406529	missense	probably damaging	1.00
IGL00518:Utrn	APN	10	12666843	splice site	probably benign
IGL00560:Utrn	APN	10	12455467	nonsense	probably null
IGL00589:Utrn	APN	10	12678618	missense	possibly damaging	0.53
IGL00662:Utrn	APN	10	12664961	missense	probably damaging	0.99
IGL00754:Utrn	APN	10	12663492	missense	probably benign	0.05
IGL00772:Utrn	APN	10	12649185	missense	probably benign
IGL00775:Utrn	APN	10	12745230	critical splice donor site	probably null
IGL00782:Utrn	APN	10	12652811	missense	probably benign	0.13
IGL00962:Utrn	APN	10	12481334	missense	possibly damaging	0.80
IGL01584:Utrn	APN	10	12726367	missense	probably benign	0.01
IGL01677:Utrn	APN	10	12744157	missense	probably damaging	1.00
IGL01695:Utrn	APN	10	12745342	missense	probably benign	0.00
IGL01743:Utrn	APN	10	12711557	missense	possibly damaging	0.94
IGL01815:Utrn	APN	10	12652716	missense	probably benign	0.00
IGL01901:Utrn	APN	10	12640928	missense	probably damaging	1.00
IGL01982:Utrn	APN	10	12748029	missense	probably damaging	1.00
IGL01983:Utrn	APN	10	12669781	missense	probably benign	0.18
IGL02031:Utrn	APN	10	12735204	missense	probably damaging	1.00
IGL02106:Utrn	APN	10	12413973	missense	possibly damaging	0.92
IGL02134:Utrn	APN	10	12643419	missense	probably damaging	0.99
IGL02209:Utrn	APN	10	12683295	missense	probably damaging	0.97
IGL02217:Utrn	APN	10	12751559	missense	probably damaging	1.00
IGL02250:Utrn	APN	10	12436391	missense	probably damaging	1.00
IGL02307:Utrn	APN	10	12750065	nonsense	probably null
IGL02386:Utrn	APN	10	12421608	missense	possibly damaging	0.91
IGL02494:Utrn	APN	10	12710054	missense	probably benign
IGL02631:Utrn	APN	10	12710063	missense	probably benign	0.00
IGL02729:Utrn	APN	10	12720810	unclassified	probably benign
IGL02736:Utrn	APN	10	12421640	missense	probably damaging	1.00
IGL02832:Utrn	APN	10	12738193	missense	possibly damaging	0.82
IGL02926:Utrn	APN	10	12690760	missense	probably damaging	0.96
IGL03184:Utrn	APN	10	12710166	missense	probably benign	0.04
IGL03194:Utrn	APN	10	12406429	splice site	probably benign
IGL03346:Utrn	APN	10	12525352	missense	probably benign	0.22
retiring	UTSW	10	12641020	missense	probably damaging	1.00
shrinking_violet	UTSW	10	12711585	critical splice acceptor site	probably null
Wallflower	UTSW	10	12747975	missense	probably damaging	1.00
FR4548:Utrn	UTSW	10	12633941	critical splice donor site	probably benign
I2288:Utrn	UTSW	10	12421640	missense	probably damaging	1.00
PIT4677001:Utrn	UTSW	10	12666704	missense	probably benign	0.06
R0022:Utrn	UTSW	10	12709956	splice site	probably benign
R0024:Utrn	UTSW	10	12406011	missense	probably benign	0.00
R0024:Utrn	UTSW	10	12406011	missense	probably benign	0.00
R0026:Utrn	UTSW	10	12726196	splice site	probably benign
R0026:Utrn	UTSW	10	12726196	splice site	probably benign
R0091:Utrn	UTSW	10	12735204	missense	probably damaging	1.00
R0112:Utrn	UTSW	10	12686465	nonsense	probably null
R0126:Utrn	UTSW	10	12711475	missense	probably benign	0.02
R0184:Utrn	UTSW	10	12667618	missense	probably benign
R0219:Utrn	UTSW	10	12684451	missense	probably damaging	1.00
R0369:Utrn	UTSW	10	12634022	missense	probably benign	0.37
R0390:Utrn	UTSW	10	12710060	missense	probably benign	0.05
R0391:Utrn	UTSW	10	12525333	splice site	probably benign
R0408:Utrn	UTSW	10	12384190	makesense	probably null
R0409:Utrn	UTSW	10	12643601	missense	probably benign	0.01
R0441:Utrn	UTSW	10	12688294	missense	probably null	0.88
R0730:Utrn	UTSW	10	12698158	splice site	probably benign
R1078:Utrn	UTSW	10	12455566	critical splice acceptor site	probably null
R1171:Utrn	UTSW	10	12481308	missense	probably damaging	0.99
R1191:Utrn	UTSW	10	12634033	missense	probably benign	0.02
R1203:Utrn	UTSW	10	12486537	missense	probably damaging	1.00
R1401:Utrn	UTSW	10	12649153	missense	probably benign
R1418:Utrn	UTSW	10	12713350	missense	probably benign
R1439:Utrn	UTSW	10	12744049	missense	possibly damaging	0.79
R1441:Utrn	UTSW	10	12683295	missense	probably damaging	0.97
R1445:Utrn	UTSW	10	12678574	splice site	probably benign
R1509:Utrn	UTSW	10	12455441	missense	possibly damaging	0.91
R1546:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1585:Utrn	UTSW	10	12436285	missense	possibly damaging	0.62
R1621:Utrn	UTSW	10	12713283	missense	probably benign	0.24
R1637:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1703:Utrn	UTSW	10	12727729	splice site	probably benign
R1725:Utrn	UTSW	10	12663519	missense	probably damaging	0.99
R1735:Utrn	UTSW	10	12710138	missense	probably benign
R1770:Utrn	UTSW	10	12475296	missense	probably damaging	0.98
R1778:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R1783:Utrn	UTSW	10	12463339	missense	probably damaging	1.00
R1818:Utrn	UTSW	10	12709964	critical splice donor site	probably null
R1829:Utrn	UTSW	10	12475274	missense	probably damaging	1.00
R1919:Utrn	UTSW	10	12455480	missense	probably benign	0.15
R1964:Utrn	UTSW	10	12684437	missense	probably damaging	1.00
R2080:Utrn	UTSW	10	12737082	missense	probably benign	0.36
R2092:Utrn	UTSW	10	12678698	missense	probably benign	0.12
R2107:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R2108:Utrn	UTSW	10	12436364	missense	probably damaging	1.00
R2760:Utrn	UTSW	10	12690878	missense	probably damaging	1.00
R2884:Utrn	UTSW	10	12739361	splice site	probably null
R2885:Utrn	UTSW	10	12739361	splice site	probably null
R2886:Utrn	UTSW	10	12739361	splice site	probably null
R2903:Utrn	UTSW	10	12643428	missense	probably damaging	1.00
R2944:Utrn	UTSW	10	12643419	missense	probably damaging	1.00
R2945:Utrn	UTSW	10	12486391	missense	possibly damaging	0.50
R3438:Utrn	UTSW	10	12481318	missense	probably damaging	0.98
R3683:Utrn	UTSW	10	12666835	missense	probably benign	0.10
R3735:Utrn	UTSW	10	12478484	missense	probably damaging	1.00
R3907:Utrn	UTSW	10	12710182	splice site	probably benign
R3923:Utrn	UTSW	10	12739479	missense	probably benign	0.23
R3925:Utrn	UTSW	10	12698042	missense	probably benign
R3926:Utrn	UTSW	10	12698042	missense	probably benign
R3938:Utrn	UTSW	10	12750030	critical splice donor site	probably null
R3941:Utrn	UTSW	10	12711585	critical splice acceptor site	probably null
R3958:Utrn	UTSW	10	12750108	missense	probably damaging	1.00
R4091:Utrn	UTSW	10	12710171	missense	probably benign	0.10
R4454:Utrn	UTSW	10	12727840	missense	possibly damaging	0.81
R4585:Utrn	UTSW	10	12688306	missense	probably benign	0.01
R4667:Utrn	UTSW	10	12698053	missense	probably benign	0.22
R4684:Utrn	UTSW	10	12745240	missense	probably damaging	1.00
R4782:Utrn	UTSW	10	12750069	missense	probably damaging	1.00
R4785:Utrn	UTSW	10	12654745	missense	probably benign	0.39
R4799:Utrn	UTSW	10	12750069	missense	probably damaging	1.00
R4829:Utrn	UTSW	10	12663461	missense	probably benign	0.00
R4878:Utrn	UTSW	10	12727758	missense	probably damaging	1.00
R4955:Utrn	UTSW	10	12861567	critical splice donor site	probably null
R4967:Utrn	UTSW	10	12455420	missense	probably damaging	0.99
R5071:Utrn	UTSW	10	12384204	splice site	probably null
R5072:Utrn	UTSW	10	12384204	splice site	probably null
R5186:Utrn	UTSW	10	12728777	missense	probably damaging	1.00
R5213:Utrn	UTSW	10	12636760	missense	probably damaging	1.00
R5296:Utrn	UTSW	10	12401355	missense	probably damaging	1.00
R5309:Utrn	UTSW	10	12727769	missense	probably damaging	1.00
R5312:Utrn	UTSW	10	12727769	missense	probably damaging	1.00
R5399:Utrn	UTSW	10	12640983	missense	probably damaging	1.00
R5407:Utrn	UTSW	10	12680625	missense	probably damaging	1.00
R5411:Utrn	UTSW	10	12649185	missense	probably benign
R5428:Utrn	UTSW	10	12693431	missense	probably benign	0.09
R5595:Utrn	UTSW	10	12682318	missense	possibly damaging	0.89
R5602:Utrn	UTSW	10	12750095	missense	probably damaging	1.00
R5608:Utrn	UTSW	10	12671837	missense	probably benign	0.00
R5678:Utrn	UTSW	10	12442018	missense	probably damaging	1.00
R5726:Utrn	UTSW	10	12669806	missense	probably benign
R5804:Utrn	UTSW	10	12421625	missense	probably damaging	1.00
R5916:Utrn	UTSW	10	12665051	missense	probably damaging	0.97
R5941:Utrn	UTSW	10	12486483	missense	probably damaging	1.00
R6014:Utrn	UTSW	10	12690876	missense	probably benign	0.01
R6015:Utrn	UTSW	10	12478424	missense	possibly damaging	0.85
R6028:Utrn	UTSW	10	12654716	missense	probably benign	0.00
R6158:Utrn	UTSW	10	12690822	missense	probably benign	0.04
R6181:Utrn	UTSW	10	12739456	missense	probably damaging	1.00
R6300:Utrn	UTSW	10	12501476	missense	probably benign	0.35
R6367:Utrn	UTSW	10	12747975	missense	probably damaging	1.00
R6377:Utrn	UTSW	10	12744083	missense	probably damaging	1.00
R6434:Utrn	UTSW	10	12525427	missense	probably damaging	1.00
R6498:Utrn	UTSW	10	12442093	missense	probably benign
R6579:Utrn	UTSW	10	12748006	missense	probably benign	0.05
R6704:Utrn	UTSW	10	12745291	missense	probably damaging	0.99
R6736:Utrn	UTSW	10	12621303	missense	probably benign	0.09
R6755:Utrn	UTSW	10	12699087	missense	probably benign	0.00
R6793:Utrn	UTSW	10	12640925	critical splice donor site	probably null
R6793:Utrn	UTSW	10	12699100	missense	possibly damaging	0.69
R6835:Utrn	UTSW	10	12727764	missense	probably damaging	1.00
R6919:Utrn	UTSW	10	12693470	nonsense	probably null
R6920:Utrn	UTSW	10	12750470	missense	probably damaging	0.98
R7037:Utrn	UTSW	10	12826770	splice site	probably null
R7038:Utrn	UTSW	10	12682338	missense	probably damaging	1.00
R7055:Utrn	UTSW	10	12747921	missense	probably benign	0.23
R7072:Utrn	UTSW	10	12465213	missense	probably damaging	1.00
R7090:Utrn	UTSW	10	12684516	missense	possibly damaging	0.58
R7211:Utrn	UTSW	10	12401335	missense	possibly damaging	0.72
R7248:Utrn	UTSW	10	12728818	missense	possibly damaging	0.51
R7305:Utrn	UTSW	10	12385536	missense	probably benign
R7334:Utrn	UTSW	10	12728009	splice site	probably null
R7348:Utrn	UTSW	10	12748018	missense	probably damaging	1.00
R7375:Utrn	UTSW	10	12641020	missense	probably damaging	1.00
R7436:Utrn	UTSW	10	12439791	missense	possibly damaging	0.72
R7476:Utrn	UTSW	10	12640951	missense	probably benign
R7514:Utrn	UTSW	10	12698089	missense	probably benign	0.00
R7527:Utrn	UTSW	10	12401382	missense	possibly damaging	0.81
R7735:Utrn	UTSW	10	12744043	critical splice donor site	probably null
R7748:Utrn	UTSW	10	12614508	missense	probably benign	0.01
R7778:Utrn	UTSW	10	12486610	missense	probably damaging	1.00
R7824:Utrn	UTSW	10	12486610	missense	probably damaging	1.00
R7826:Utrn	UTSW	10	12401306	splice site	probably null
R7872:Utrn	UTSW	10	12698129	missense	probably benign
R7915:Utrn	UTSW	10	12465212	missense	probably damaging	1.00
R7922:Utrn	UTSW	10	12667527	missense	possibly damaging	0.68
R8081:Utrn	UTSW	10	12548059	start gained	probably benign
R8132:Utrn	UTSW	10	12682410	missense	probably damaging	0.99
R8167:Utrn	UTSW	10	12671814	nonsense	probably null
R8186:Utrn	UTSW	10	12698123	missense	probably benign
R8331:Utrn	UTSW	10	12614619	missense	probably benign	0.00
R8352:Utrn	UTSW	10	12813509	missense	probably benign	0.34
R8408:Utrn	UTSW	10	12670143	missense	possibly damaging	0.69
R8452:Utrn	UTSW	10	12813509	missense	probably benign	0.34
R8478:Utrn	UTSW	10	12649148	missense	probably benign
R8489:Utrn	UTSW	10	12711446	missense	probably benign	0.05
R8516:Utrn	UTSW	10	12486510	missense	probably damaging	0.99
R8520:Utrn	UTSW	10	12670186	nonsense	probably null
R8550:Utrn	UTSW	10	12813585	intron	probably benign
R8856:Utrn	UTSW	10	12667607	missense	probably benign
R8881:Utrn	UTSW	10	12547993	missense	possibly damaging	0.46
R9180:Utrn	UTSW	10	12669719	missense	probably damaging	1.00
R9186:Utrn	UTSW	10	12614574	missense	probably benign
R9216:Utrn	UTSW	10	12813485	missense	probably benign	0.19
R9251:Utrn	UTSW	10	12636787	missense	probably benign	0.01
R9273:Utrn	UTSW	10	12633963	missense	probably damaging	0.97
R9307:Utrn	UTSW	10	12678731	missense	probably benign	0.02
R9344:Utrn	UTSW	10	12684531	missense	probably benign	0.17
R9419:Utrn	UTSW	10	12688381	missense	probably damaging	1.00
R9435:Utrn	UTSW	10	12643429	missense	probably damaging	1.00
R9623:Utrn	UTSW	10	12406481	missense	probably damaging	1.00
R9650:Utrn	UTSW	10	12738185	missense	probably benign	0.00
R9653:Utrn	UTSW	10	12621379	missense	probably benign	0.17
R9653:Utrn	UTSW	10	12663445	missense	probably benign	0.41
R9672:Utrn	UTSW	10	12727869	missense	possibly damaging	0.68
R9678:Utrn	UTSW	10	12739415	missense	probably benign	0.00
R9741:Utrn	UTSW	10	12826820	missense	probably benign
R9765:Utrn	UTSW	10	12735177	missense	probably damaging	0.99
R9799:Utrn	UTSW	10	12709992	missense	probably benign	0.01
RF009:Utrn	UTSW	10	12633945	nonsense	probably null
V1662:Utrn	UTSW	10	12421640	missense	probably damaging	1.00
X0018:Utrn	UTSW	10	12735198	missense	probably damaging	1.00
Z1176:Utrn	UTSW	10	12682360	nonsense	probably null
Z1176:Utrn	UTSW	10	12688429	critical splice acceptor site	probably null
Z1177:Utrn	UTSW	10	12525406	nonsense	probably null
Z1177:Utrn	UTSW	10	12621379	missense	probably benign	0.17
Z1186:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1189:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1191:Utrn	UTSW	10	12669747	missense	probably damaging	1.00
Z1192:Utrn	UTSW	10	12669747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGGCTACTCTTCAGCATTAGGTTC -3'
(R):5'- TCCTTTCTAGGTTGCAGGCATCTTTC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TAGGTTGCAGGCATCTTTCTTACTC -3'

Posted On

2013-06-12