Mutagenetix > Incidental Mutation

Incidental Mutation 'R0504:Syne2'

47380

Institutional Source

Beutler Lab

Gene Symbol

Syne2

Ensembl Gene

ENSMUSG00000063450

Gene Name

spectrin repeat containing, nuclear envelope 2

Synonyms

syne-2, D12Ertd777e, nesprin-2, 6820443O06Rik, Nesp2g

MMRRC Submission

038699-MU

Accession Numbers

Genbank: NM_001005510

Essential gene?

Possibly non essential (E-score: 0.412) question?

Stock #

R0504 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75818134-76110926 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 76033591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119120 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000143031]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044217

SMART Domains

Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450

Domain	Start	End	E-Value	Type
CH	33	134	7.97e-19	SMART
low complexity region	151	175	N/A	INTRINSIC
CH	185	283	1.34e-20	SMART
low complexity region	494	505	N/A	INTRINSIC
coiled coil region	541	572	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
coiled coil region	844	869	N/A	INTRINSIC
coiled coil region	936	969	N/A	INTRINSIC
coiled coil region	1006	1032	N/A	INTRINSIC
SPEC	1427	1525	4.96e0	SMART
SPEC	1528	1632	2.48e-1	SMART
coiled coil region	1660	1699	N/A	INTRINSIC
SPEC	2034	2131	1.83e0	SMART
coiled coil region	2173	2194	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
coiled coil region	2316	2348	N/A	INTRINSIC
SPEC	2720	2820	1.44e-5	SMART
coiled coil region	2905	2934	N/A	INTRINSIC
coiled coil region	2962	2989	N/A	INTRINSIC
coiled coil region	3108	3136	N/A	INTRINSIC
low complexity region	3333	3350	N/A	INTRINSIC
low complexity region	3514	3523	N/A	INTRINSIC
low complexity region	3666	3676	N/A	INTRINSIC
coiled coil region	3678	3708	N/A	INTRINSIC
coiled coil region	3761	3788	N/A	INTRINSIC
coiled coil region	3846	3903	N/A	INTRINSIC
coiled coil region	4015	4067	N/A	INTRINSIC
low complexity region	4102	4115	N/A	INTRINSIC
coiled coil region	4483	4511	N/A	INTRINSIC
low complexity region	4557	4569	N/A	INTRINSIC
coiled coil region	4655	4688	N/A	INTRINSIC
low complexity region	4749	4763	N/A	INTRINSIC
SPEC	4827	4926	5.25e-1	SMART
SPEC	4933	5038	2.64e-4	SMART
SPEC	5048	5152	1.47e-2	SMART
SPEC	5159	5259	4.29e0	SMART
SPEC	5263	5371	4.47e0	SMART
low complexity region	5373	5393	N/A	INTRINSIC
SPEC	5583	5681	5.7e-1	SMART
Blast:SPEC	5690	5793	2e-53	BLAST
SPEC	5800	5900	2.11e0	SMART
SPEC	5907	6005	6.91e-8	SMART
SPEC	6012	6119	4.45e-11	SMART
SPEC	6126	6228	6.39e-12	SMART
SPEC	6235	6335	7.75e-11	SMART
SPEC	6539	6642	5.53e-7	SMART
SPEC	6649	6753	5.12e-2	SMART
KASH	6817	6874	8.17e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085280

SMART Domains

Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
SPEC	88	187	5.25e-1	SMART
SPEC	194	299	2.64e-4	SMART
SPEC	309	413	1.47e-2	SMART
SPEC	420	520	4.29e0	SMART
SPEC	524	632	4.47e0	SMART
low complexity region	634	654	N/A	INTRINSIC
SPEC	844	942	5.7e-1	SMART
Blast:SPEC	951	1054	2e-53	BLAST
SPEC	1061	1161	2.11e0	SMART
SPEC	1168	1266	6.91e-8	SMART
SPEC	1273	1380	4.45e-11	SMART
SPEC	1387	1489	6.39e-12	SMART
SPEC	1496	1596	7.75e-11	SMART
SPEC	1823	1926	5.53e-7	SMART
SPEC	1933	2037	5.12e-2	SMART
KASH	2095	2152	8.17e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143031

SMART Domains

Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450

Domain	Start	End	E-Value	Type
CH	33	134	7.97e-19	SMART
low complexity region	151	175	N/A	INTRINSIC
CH	185	283	1.34e-20	SMART
low complexity region	494	505	N/A	INTRINSIC
coiled coil region	541	572	N/A	INTRINSIC
coiled coil region	845	870	N/A	INTRINSIC
coiled coil region	937	970	N/A	INTRINSIC
coiled coil region	1007	1033	N/A	INTRINSIC
SPEC	1428	1526	4.96e0	SMART
SPEC	1529	1633	2.48e-1	SMART
coiled coil region	1661	1700	N/A	INTRINSIC
SPEC	2035	2132	1.83e0	SMART
coiled coil region	2174	2195	N/A	INTRINSIC
low complexity region	2296	2308	N/A	INTRINSIC
coiled coil region	2317	2349	N/A	INTRINSIC
SPEC	2721	2821	1.44e-5	SMART
coiled coil region	2906	2935	N/A	INTRINSIC
coiled coil region	2963	2990	N/A	INTRINSIC
coiled coil region	3109	3137	N/A	INTRINSIC
low complexity region	3334	3351	N/A	INTRINSIC
low complexity region	3515	3524	N/A	INTRINSIC
low complexity region	3667	3677	N/A	INTRINSIC
coiled coil region	3679	3709	N/A	INTRINSIC
coiled coil region	3762	3789	N/A	INTRINSIC
coiled coil region	3847	3904	N/A	INTRINSIC
coiled coil region	4016	4068	N/A	INTRINSIC
low complexity region	4103	4116	N/A	INTRINSIC
coiled coil region	4484	4512	N/A	INTRINSIC
low complexity region	4558	4570	N/A	INTRINSIC
coiled coil region	4656	4689	N/A	INTRINSIC
low complexity region	4750	4764	N/A	INTRINSIC
SPEC	4828	4927	5.25e-1	SMART
SPEC	4934	5039	2.64e-4	SMART
SPEC	5049	5153	1.47e-2	SMART
SPEC	5160	5260	4.29e0	SMART
SPEC	5264	5372	4.47e0	SMART
low complexity region	5374	5394	N/A	INTRINSIC
SPEC	5584	5682	5.7e-1	SMART
Blast:SPEC	5691	5794	2e-53	BLAST
SPEC	5801	5901	2.11e0	SMART
SPEC	5908	6006	6.91e-8	SMART
SPEC	6013	6120	4.45e-11	SMART
SPEC	6127	6229	6.39e-12	SMART
SPEC	6236	6336	7.75e-11	SMART
SPEC	6540	6643	5.53e-7	SMART
SPEC	6650	6754	5.12e-2	SMART
KASH	6813	6870	8.17e-34	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

99% (145/147)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock

Total: 145 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	G	4: 103,270,860		probably benign	Het
4931440F15Rik	T	C	11: 29,824,990	I156V	probably damaging	Het
Adamts6	T	C	13: 104,426,930		probably benign	Het
Adamts9	T	A	6: 92,912,645	Y316F	probably damaging	Het
Agl	A	T	3: 116,786,784	F374I	probably damaging	Het
Akr1c19	A	G	13: 4,236,251	T83A	possibly damaging	Het
Ankrd36	T	A	11: 5,629,274	S179R	probably damaging	Het
Appbp2	A	G	11: 85,191,687	S573P	probably benign	Het
Arid4a	T	A	12: 71,047,214	F254I	probably damaging	Het
Asna1	A	C	8: 85,018,607	V277G	probably damaging	Het
Bin3	T	C	14: 70,123,887		probably null	Het
Bmi1	T	C	2: 18,684,072		probably null	Het
Bmper	G	T	9: 23,406,687	C534F	probably damaging	Het
Bora	T	A	14: 99,061,623	C205*	probably null	Het
Btnl2	A	G	17: 34,358,117	E82G	probably benign	Het
Ccdc8	A	T	7: 16,996,014	D476V	unknown	Het
Ccr3	C	A	9: 124,029,441	T271K	possibly damaging	Het
Cd276	A	G	9: 58,540,678	L23P	possibly damaging	Het
Cd3e	T	C	9: 45,002,254	Q61R	probably benign	Het
Cep97	A	G	16: 55,905,779	S582P	probably benign	Het
Chml	A	T	1: 175,687,182	M391K	probably damaging	Het
Chst1	A	G	2: 92,613,824	N214D	probably benign	Het
Chuk	T	C	19: 44,081,938		probably benign	Het
Col12a1	G	A	9: 79,681,468	H1122Y	possibly damaging	Het
Cpne6	A	G	14: 55,514,602	K272R	probably damaging	Het
Cpsf2	T	A	12: 101,990,003	L355Q	probably damaging	Het
Cyp2c29	T	A	19: 39,309,780	D256E	probably benign	Het
Daglb	G	A	5: 143,494,197	V420I	probably benign	Het
Ddx42	G	T	11: 106,247,849	G825C	probably benign	Het
Dis3	T	C	14: 99,081,390		probably benign	Het
Dkk4	C	T	8: 22,625,343	R70C	probably damaging	Het
Dock6	G	T	9: 21,802,436	Q1933K	probably damaging	Het
Dpep2	T	G	8: 105,989,988	Q186H	probably benign	Het
Dzip3	A	C	16: 48,959,643		probably benign	Het
Egflam	T	A	15: 7,222,758	I853F	probably damaging	Het
Fastkd5	A	G	2: 130,615,917	I251T	probably benign	Het
Fbn2	T	A	18: 58,039,460	D2091V	possibly damaging	Het
Fer1l4	C	A	2: 156,052,195	V63L	probably benign	Het
Frem1	T	A	4: 82,912,637	D2062V	probably benign	Het
Galnt6	A	C	15: 100,696,657		probably benign	Het
Gm10972	A	T	3: 94,643,133		probably benign	Het
Gm4846	G	A	1: 166,491,545	T208I	probably benign	Het
Gorab	A	G	1: 163,386,605	L252P	probably damaging	Het
Gtsf2	A	G	15: 103,444,561	C63R	probably damaging	Het
Hal	T	C	10: 93,489,174	V15A	probably damaging	Het
Hmcn1	A	T	1: 150,876,419		probably benign	Het
Hormad2	A	T	11: 4,408,833	H191Q	possibly damaging	Het
Hspa2	A	T	12: 76,405,216	D228V	probably damaging	Het
Igfn1	A	T	1: 135,968,529	M1433K	probably benign	Het
Il18	A	G	9: 50,575,328	D19G	probably damaging	Het
Il1rl2	G	A	1: 40,329,056	V129I	probably benign	Het
Inpp5b	C	A	4: 124,782,408	Y352*	probably null	Het
Insrr	A	T	3: 87,813,156	M1034L	possibly damaging	Het
Jmjd1c	T	C	10: 67,225,755	S1296P	probably damaging	Het
Kdm5b	G	T	1: 134,621,023		probably null	Het
Krba1	C	T	6: 48,416,254	T998I	probably benign	Het
L3mbtl4	A	G	17: 68,777,912	N606S	probably benign	Het
Lonrf1	T	A	8: 36,231,159	N395I	possibly damaging	Het
Lpp	A	G	16: 24,971,970	D393G	probably damaging	Het
Lrrc17	A	G	5: 21,560,530	I3M	probably benign	Het
Lrrtm4	A	T	6: 80,022,046	Q147L	probably damaging	Het
Map1a	A	G	2: 121,302,941	M1413V	probably benign	Het
Mapk8ip2	A	G	15: 89,456,658	E102G	possibly damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mdn1	T	C	4: 32,698,916		probably benign	Het
Mfng	A	C	15: 78,757,314	H294Q	probably benign	Het
Mical2	T	A	7: 112,271,317	N4K	probably benign	Het
Mov10l1	T	A	15: 88,998,839	V384E	probably damaging	Het
Myo18b	A	G	5: 112,873,576		probably benign	Het
Nlrp1b	T	G	11: 71,182,415	I201L	probably damaging	Het
Nos2	C	T	11: 78,940,077	P249L	probably damaging	Het
Notch4	A	G	17: 34,575,091	T681A	probably damaging	Het
Nr1i3	C	T	1: 171,217,236		probably benign	Het
Obscn	A	G	11: 59,008,507		probably null	Het
Olfr1024	T	A	2: 85,904,686	M123L	possibly damaging	Het
Olfr1230	C	T	2: 89,296,739	C177Y	probably damaging	Het
Olfr1248	A	T	2: 89,618,094	Y33N	probably damaging	Het
Olfr237-ps1	A	T	6: 43,153,461	H52L	probably benign	Het
Olfr328	C	A	11: 58,551,636	C201F	probably damaging	Het
Olfr452	C	T	6: 42,790,596	R186*	probably null	Het
Olfr517	C	T	7: 108,868,850	M101I	possibly damaging	Het
Olfr654	C	T	7: 104,588,475	R224*	probably null	Het
Olfr705	T	A	7: 106,714,701		probably benign	Het
Olfr881	A	G	9: 37,993,142	T217A	probably benign	Het
Onecut2	A	T	18: 64,340,749	I124F	possibly damaging	Het
Otol1	G	A	3: 70,027,604	G310R	probably damaging	Het
Oxct2b	T	A	4: 123,116,840	S184R	possibly damaging	Het
Oxct2b	ACTG	A	4: 123,116,912		probably benign	Het
P2rx6	A	G	16: 17,567,427		probably benign	Het
Pde4a	A	G	9: 21,204,403	N411S	probably damaging	Het
Phkb	A	T	8: 86,056,524	D983V	probably benign	Het
Piezo2	G	A	18: 63,024,451	T2396I	probably damaging	Het
Pik3ap1	T	A	19: 41,287,490	D717V	probably damaging	Het
Plce1	T	A	19: 38,778,021		probably benign	Het
Plekhg1	A	G	10: 3,937,853	I261V	probably damaging	Het
Ppfia4	T	C	1: 134,324,113	H441R	probably damaging	Het
Prpf8	T	A	11: 75,501,942		probably benign	Het
Ptn	T	A	6: 36,741,453		probably benign	Het
Ptpn13	A	G	5: 103,501,496	Y255C	possibly damaging	Het
Ptpn4	A	G	1: 119,765,915	Y126H	probably damaging	Het
Ptprc	T	C	1: 138,088,697	N505D	probably damaging	Het
Ptprs	T	A	17: 56,454,220	I116F	possibly damaging	Het
Rab1a	T	G	11: 20,223,169	V90G	probably damaging	Het
Rcor1	T	C	12: 111,101,668	V267A	probably benign	Het
Reep4	A	G	14: 70,547,238		probably null	Het
Rere	T	A	4: 150,615,322		probably benign	Het
Rin3	T	A	12: 102,387,564	Y743*	probably null	Het
Rprm	A	G	2: 54,085,055	S84P	probably damaging	Het
Sdhaf2	C	T	19: 10,517,019	E109K	probably damaging	Het
Sec31b	G	T	19: 44,534,786	Q24K	probably damaging	Het
Sema5a	T	C	15: 32,574,803		probably benign	Het
Sh3pxd2a	T	C	19: 47,267,747	Y844C	probably damaging	Het
Shmt2	A	C	10: 127,520,072	N134K	probably damaging	Het
Slc9a8	C	T	2: 167,424,205	A34V	probably benign	Het
Spidr	A	C	16: 16,140,072	S64A	possibly damaging	Het
Stk10	A	G	11: 32,617,882	T895A	probably benign	Het
Szt2	T	C	4: 118,372,952		probably null	Het
Tecpr1	A	T	5: 144,214,081	V303D	probably damaging	Het
Tet3	A	G	6: 83,373,794	Y1048H	probably damaging	Het
Tfb2m	A	G	1: 179,545,831	C101R	probably damaging	Het
Tg	T	C	15: 66,682,404	V556A	probably damaging	Het
Thbs4	A	C	13: 92,767,184	I441M	probably benign	Het
Thsd7a	A	T	6: 12,379,594	Y944N	probably damaging	Het
Tm9sf3	C	A	19: 41,247,892		probably benign	Het
Tmem145	T	C	7: 25,311,362	F359S	probably damaging	Het
Ttc21b	C	T	2: 66,222,798		probably benign	Het
Ttn	A	G	2: 76,749,536	V23671A	probably damaging	Het
Txnl4b	T	C	8: 109,571,471	I78T	probably benign	Het
Ubr4	C	A	4: 139,406,578	L762I	probably damaging	Het
Ubr4	T	C	4: 139,480,838		probably null	Het
Ugt1a8	C	T	1: 88,088,357	P164L	probably damaging	Het
Unc13b	T	C	4: 43,263,559	S1594P	probably damaging	Het
Utrn	A	T	10: 12,402,895	F912I	probably benign	Het
Vat1l	T	C	8: 114,236,579		probably benign	Het
Vmn1r50	T	A	6: 90,107,881	S203T	probably damaging	Het
Vmn2r4	A	T	3: 64,389,363	L667Q	probably damaging	Het
Vmn2r66	T	G	7: 85,006,815	Q331P	probably damaging	Het
Wdsub1	A	T	2: 59,878,325	V68D	possibly damaging	Het
Wnk2	C	G	13: 49,085,394	A564P	possibly damaging	Het
Wnk2	T	A	13: 49,085,396	K563M	probably damaging	Het
Zan	T	A	5: 137,470,318	H297L	probably damaging	Het
Zfp426	A	T	9: 20,470,031	H539Q	probably damaging	Het
Zfp488	T	A	14: 33,970,540	N222I	probably damaging	Het
Zfp536	T	A	7: 37,568,818	H391L	probably damaging	Het
Zp1	T	A	19: 10,916,207	N31I	probably damaging	Het

Other mutations in Syne2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Syne2	APN	12	76031700	unclassified	probably benign
IGL00595:Syne2	APN	12	75925646	missense	possibly damaging	0.76
IGL00672:Syne2	APN	12	76064184	missense	probably damaging	1.00
IGL00781:Syne2	APN	12	76024062	missense	probably benign	0.00
IGL00823:Syne2	APN	12	75989242	missense	probably damaging	0.98
IGL01014:Syne2	APN	12	75905277	missense	probably damaging	0.99
IGL01074:Syne2	APN	12	76031587	nonsense	probably null
IGL01074:Syne2	APN	12	75987011	missense	probably benign	0.00
IGL01324:Syne2	APN	12	76043752	missense	probably damaging	1.00
IGL01325:Syne2	APN	12	75926514	missense	probably benign	0.01
IGL01331:Syne2	APN	12	75929253	splice site	probably benign
IGL01338:Syne2	APN	12	76060226	missense	possibly damaging	0.55
IGL01373:Syne2	APN	12	75987107	missense	probably damaging	1.00
IGL01446:Syne2	APN	12	76041375	missense	probably damaging	1.00
IGL01556:Syne2	APN	12	76087815	missense	probably damaging	1.00
IGL01585:Syne2	APN	12	75949060	critical splice acceptor site	probably null
IGL01629:Syne2	APN	12	76004603	missense	possibly damaging	0.49
IGL01686:Syne2	APN	12	75909336	missense	probably benign
IGL01935:Syne2	APN	12	75925313	missense	probably damaging	1.00
IGL01941:Syne2	APN	12	75967220	missense	probably benign	0.01
IGL01956:Syne2	APN	12	76097974	missense	probably damaging	1.00
IGL01967:Syne2	APN	12	75941303	missense	probably damaging	1.00
IGL01990:Syne2	APN	12	76054933	missense	probably damaging	1.00
IGL02000:Syne2	APN	12	76015645	missense	probably damaging	0.99
IGL02063:Syne2	APN	12	76052100	missense	probably damaging	0.96
IGL02069:Syne2	APN	12	75927412	missense	probably benign	0.13
IGL02120:Syne2	APN	12	75946706	missense	probably damaging	1.00
IGL02222:Syne2	APN	12	75952843	missense	probably damaging	0.96
IGL02223:Syne2	APN	12	76108305	missense	probably benign	0.00
IGL02321:Syne2	APN	12	75918999	missense	possibly damaging	0.58
IGL02488:Syne2	APN	12	75965738	missense	probably benign	0.24
IGL02491:Syne2	APN	12	76072179	missense	probably benign	0.10
IGL02525:Syne2	APN	12	76101003	missense	probably damaging	0.99
IGL02578:Syne2	APN	12	76022279	missense	possibly damaging	0.76
IGL02615:Syne2	APN	12	76096994	missense	probably damaging	1.00
IGL02702:Syne2	APN	12	76097924	missense	probably damaging	1.00
IGL02726:Syne2	APN	12	76015582	missense	probably damaging	0.99
IGL02795:Syne2	APN	12	75966549	missense	probably damaging	0.99
IGL02803:Syne2	APN	12	76031546	missense	probably damaging	1.00
IGL02814:Syne2	APN	12	75945376	missense	possibly damaging	0.64
IGL03013:Syne2	APN	12	75929337	missense	probably benign	0.00
IGL03131:Syne2	APN	12	76057490	missense	probably damaging	1.00
IGL03152:Syne2	APN	12	75965712	missense	probably benign	0.12
IGL03216:Syne2	APN	12	75942961	splice site	probably benign
IGL03228:Syne2	APN	12	75979912	missense	probably benign	0.01
IGL03259:Syne2	APN	12	75989079	missense	probably benign	0.05
IGL03374:Syne2	APN	12	76074586	missense	possibly damaging	0.66
IGL03375:Syne2	APN	12	75925435	missense	possibly damaging	0.57
3-1:Syne2	UTSW	12	75930632	missense	probably benign	0.02
B5639:Syne2	UTSW	12	75929790	missense	probably benign
K3955:Syne2	UTSW	12	75930665	missense	probably damaging	1.00
P0026:Syne2	UTSW	12	75880220	splice site	probably benign
PIT4514001:Syne2	UTSW	12	76105015	missense	probably damaging	0.99
R0089:Syne2	UTSW	12	75963876	missense	probably damaging	1.00
R0110:Syne2	UTSW	12	76097960	nonsense	probably null
R0113:Syne2	UTSW	12	75930578	missense	probably damaging	1.00
R0113:Syne2	UTSW	12	76033722	missense	probably damaging	1.00
R0141:Syne2	UTSW	12	75941298	missense	probably damaging	1.00
R0211:Syne2	UTSW	12	76097957	missense	probably damaging	1.00
R0219:Syne2	UTSW	12	76042004	missense	probably damaging	1.00
R0242:Syne2	UTSW	12	76098034	missense	probably damaging	1.00
R0242:Syne2	UTSW	12	76098034	missense	probably damaging	1.00
R0279:Syne2	UTSW	12	76095613	missense	probably damaging	1.00
R0319:Syne2	UTSW	12	76064162	missense	probably damaging	0.99
R0325:Syne2	UTSW	12	75962641	missense	probably benign	0.00
R0329:Syne2	UTSW	12	75966953	missense	probably benign
R0330:Syne2	UTSW	12	75966953	missense	probably benign
R0361:Syne2	UTSW	12	75918610	missense	probably benign	0.22
R0363:Syne2	UTSW	12	76072207	missense	probably damaging	0.98
R0367:Syne2	UTSW	12	75880177	missense	probably damaging	1.00
R0371:Syne2	UTSW	12	75933845	missense	probably damaging	1.00
R0374:Syne2	UTSW	12	75921226	nonsense	probably null
R0388:Syne2	UTSW	12	75986975	missense	probably benign	0.41
R0411:Syne2	UTSW	12	76059584	splice site	probably null
R0432:Syne2	UTSW	12	75949064	missense	probably damaging	0.99
R0469:Syne2	UTSW	12	75854149	critical splice donor site	probably null
R0492:Syne2	UTSW	12	75982063	critical splice donor site	probably null
R0496:Syne2	UTSW	12	76038940	missense	possibly damaging	0.80
R0505:Syne2	UTSW	12	76099464	missense	probably damaging	1.00
R0510:Syne2	UTSW	12	75854149	critical splice donor site	probably null
R0518:Syne2	UTSW	12	76108862	critical splice acceptor site	probably null
R0539:Syne2	UTSW	12	76024121	missense	possibly damaging	0.69
R0552:Syne2	UTSW	12	75931004	missense	probably benign	0.00
R0557:Syne2	UTSW	12	75929301	missense	probably benign	0.04
R0567:Syne2	UTSW	12	75890230	missense	probably damaging	0.98
R0599:Syne2	UTSW	12	76097960	nonsense	probably null
R0602:Syne2	UTSW	12	76097960	nonsense	probably null
R0608:Syne2	UTSW	12	75963813	missense	probably damaging	1.00
R0614:Syne2	UTSW	12	75912353	splice site	probably null
R0636:Syne2	UTSW	12	75930983	missense	possibly damaging	0.75
R0647:Syne2	UTSW	12	75888203	missense	probably benign
R0654:Syne2	UTSW	12	76097960	nonsense	probably null
R0658:Syne2	UTSW	12	76094336	missense	probably damaging	1.00
R0666:Syne2	UTSW	12	75923013	missense	probably damaging	0.99
R0707:Syne2	UTSW	12	75982063	critical splice donor site	probably null
R0714:Syne2	UTSW	12	76097960	nonsense	probably null
R0841:Syne2	UTSW	12	76074435	splice site	probably benign
R0848:Syne2	UTSW	12	76097959	frame shift	probably null
R0848:Syne2	UTSW	12	76097960	nonsense	probably null
R1077:Syne2	UTSW	12	76042035	missense	possibly damaging	0.94
R1103:Syne2	UTSW	12	76109835	missense	probably benign	0.00
R1144:Syne2	UTSW	12	75966524	missense	probably benign	0.04
R1194:Syne2	UTSW	12	75934513	missense	probably damaging	1.00
R1247:Syne2	UTSW	12	75967490	missense	probably benign	0.39
R1276:Syne2	UTSW	12	75941189	critical splice acceptor site	probably null
R1343:Syne2	UTSW	12	76033643	missense	probably damaging	1.00
R1442:Syne2	UTSW	12	75946715	missense	probably damaging	1.00
R1448:Syne2	UTSW	12	76020325	splice site	probably null
R1448:Syne2	UTSW	12	76052178	missense	possibly damaging	0.56
R1522:Syne2	UTSW	12	76103783	missense	probably damaging	0.98
R1528:Syne2	UTSW	12	75966100	missense	probably benign	0.00
R1636:Syne2	UTSW	12	76004732	missense	probably benign	0.01
R1637:Syne2	UTSW	12	75996002	missense	probably damaging	1.00
R1650:Syne2	UTSW	12	75904259	nonsense	probably null
R1654:Syne2	UTSW	12	76101094	missense	possibly damaging	0.56
R1714:Syne2	UTSW	12	76054939	missense	probably benign	0.26
R1750:Syne2	UTSW	12	76052805	missense	probably damaging	1.00
R1772:Syne2	UTSW	12	75938729	missense	probably benign	0.19
R1797:Syne2	UTSW	12	75963783	missense	probably benign	0.00
R1830:Syne2	UTSW	12	76109862	missense	probably damaging	1.00
R1837:Syne2	UTSW	12	75967660	missense	probably damaging	0.99
R1908:Syne2	UTSW	12	76094279	critical splice acceptor site	probably null
R1913:Syne2	UTSW	12	75899246	missense	possibly damaging	0.60
R1944:Syne2	UTSW	12	76074544	missense	probably damaging	1.00
R1950:Syne2	UTSW	12	75952870	missense	probably benign
R1958:Syne2	UTSW	12	75969545	missense	probably benign	0.11
R2018:Syne2	UTSW	12	76074579	missense	probably damaging	1.00
R2037:Syne2	UTSW	12	76025569	missense	probably benign	0.04
R2067:Syne2	UTSW	12	75888342	critical splice donor site	probably null
R2073:Syne2	UTSW	12	76015579	missense	possibly damaging	0.54
R2099:Syne2	UTSW	12	75979973	missense	probably benign	0.06
R2102:Syne2	UTSW	12	76028079	missense	probably benign	0.01
R2134:Syne2	UTSW	12	75952786	missense	probably damaging	0.99
R2135:Syne2	UTSW	12	75952786	missense	probably damaging	0.99
R2157:Syne2	UTSW	12	76094456	missense	probably damaging	1.00
R2173:Syne2	UTSW	12	76100989	splice site	probably benign
R2248:Syne2	UTSW	12	76096904	missense	probably damaging	1.00
R2276:Syne2	UTSW	12	75927466	missense	possibly damaging	0.87
R2277:Syne2	UTSW	12	75927466	missense	possibly damaging	0.87
R2278:Syne2	UTSW	12	75927466	missense	possibly damaging	0.87
R2279:Syne2	UTSW	12	75927466	missense	possibly damaging	0.87
R2483:Syne2	UTSW	12	76095537	missense	probably damaging	1.00
R2877:Syne2	UTSW	12	76000831	missense	probably benign	0.00
R2884:Syne2	UTSW	12	75963759	missense	probably benign	0.00
R3119:Syne2	UTSW	12	75909284	missense	probably benign	0.01
R3499:Syne2	UTSW	12	76054978	splice site	probably null
R3827:Syne2	UTSW	12	75987031	missense	probably benign	0.02
R3847:Syne2	UTSW	12	76048622	missense	probably damaging	1.00
R3849:Syne2	UTSW	12	76046065	nonsense	probably null
R3850:Syne2	UTSW	12	76048622	missense	probably damaging	1.00
R3859:Syne2	UTSW	12	75929784	missense	possibly damaging	0.55
R3861:Syne2	UTSW	12	75966479	missense	probably damaging	0.98
R4078:Syne2	UTSW	12	76035624	missense	probably damaging	1.00
R4116:Syne2	UTSW	12	75931079	missense	probably damaging	1.00
R4326:Syne2	UTSW	12	75952742	missense	probably damaging	1.00
R4335:Syne2	UTSW	12	76028092	missense	probably damaging	1.00
R4410:Syne2	UTSW	12	76094393	missense	probably damaging	1.00
R4412:Syne2	UTSW	12	76106060	missense	probably benign	0.01
R4444:Syne2	UTSW	12	76023030	missense	probably damaging	1.00
R4595:Syne2	UTSW	12	75967071	missense	possibly damaging	0.88
R4604:Syne2	UTSW	12	75967710	missense	probably damaging	0.99
R4606:Syne2	UTSW	12	75989253	missense	probably damaging	1.00
R4651:Syne2	UTSW	12	75989239	missense	probably damaging	0.99
R4656:Syne2	UTSW	12	76031373	missense	probably damaging	1.00
R4675:Syne2	UTSW	12	75949301	missense	probably damaging	1.00
R4790:Syne2	UTSW	12	76020391	missense	probably benign	0.19
R4791:Syne2	UTSW	12	75909244	missense	possibly damaging	0.96
R4799:Syne2	UTSW	12	75899167	missense	probably benign	0.04
R4836:Syne2	UTSW	12	75979819	missense	probably damaging	1.00
R4880:Syne2	UTSW	12	75979819	missense	probably damaging	1.00
R4881:Syne2	UTSW	12	75979819	missense	probably damaging	1.00
R4899:Syne2	UTSW	12	75854101	missense	probably benign	0.03
R4934:Syne2	UTSW	12	75899272	missense	probably benign	0.14
R4981:Syne2	UTSW	12	75941219	missense	probably damaging	0.98
R4996:Syne2	UTSW	12	75943950	missense	possibly damaging	0.87
R5056:Syne2	UTSW	12	75909131	unclassified	probably benign
R5066:Syne2	UTSW	12	75966551	missense	probably benign	0.05
R5095:Syne2	UTSW	12	75952826	missense	probably damaging	0.99
R5151:Syne2	UTSW	12	76043710	missense	probably benign	0.06
R5193:Syne2	UTSW	12	76094420	missense	probably damaging	1.00
R5267:Syne2	UTSW	12	75938741	missense	possibly damaging	0.74
R5288:Syne2	UTSW	12	76099338	missense	possibly damaging	0.94
R5402:Syne2	UTSW	12	76059439	missense	probably damaging	0.98
R5434:Syne2	UTSW	12	75971875	missense	probably damaging	1.00
R5441:Syne2	UTSW	12	75989143	missense	possibly damaging	0.75
R5488:Syne2	UTSW	12	75888172	missense	probably benign	0.13
R5497:Syne2	UTSW	12	75880389	missense	probably benign	0.19
R5506:Syne2	UTSW	12	75938721	missense	probably benign	0.01
R5509:Syne2	UTSW	12	75921244	missense	probably damaging	1.00
R5518:Syne2	UTSW	12	75945170	missense	possibly damaging	0.88
R5561:Syne2	UTSW	12	76094458	nonsense	probably null
R5581:Syne2	UTSW	12	75945085	missense	probably benign	0.01
R5625:Syne2	UTSW	12	76095112	missense	probably benign	0.06
R5642:Syne2	UTSW	12	75918532	missense	probably damaging	1.00
R5665:Syne2	UTSW	12	76108217	critical splice donor site	probably null
R5666:Syne2	UTSW	12	75950959	missense	probably benign	0.16
R5670:Syne2	UTSW	12	75950959	missense	probably benign	0.16
R5691:Syne2	UTSW	12	76027856	frame shift	probably null
R5696:Syne2	UTSW	12	75994145	missense	probably benign	0.00
R5720:Syne2	UTSW	12	75967667	missense	probably benign	0.03
R5739:Syne2	UTSW	12	75997465	missense	possibly damaging	0.53
R5840:Syne2	UTSW	12	75880291	splice site	probably null
R5846:Syne2	UTSW	12	76028124	missense	probably benign	0.01
R5850:Syne2	UTSW	12	76097975	missense	probably damaging	1.00
R5889:Syne2	UTSW	12	76072252	nonsense	probably null
R5912:Syne2	UTSW	12	75908947	critical splice donor site	probably null
R5931:Syne2	UTSW	12	76008865	missense	probably benign	0.37
R5985:Syne2	UTSW	12	75966159	missense	probably damaging	0.96
R5988:Syne2	UTSW	12	75929417	critical splice donor site	probably null
R5990:Syne2	UTSW	12	76024144	missense	probably benign	0.10
R6038:Syne2	UTSW	12	75878384	nonsense	probably null
R6038:Syne2	UTSW	12	75878384	nonsense	probably null
R6132:Syne2	UTSW	12	75945147	missense	probably benign	0.14
R6136:Syne2	UTSW	12	75905325	missense	probably benign	0.24
R6229:Syne2	UTSW	12	75921220	missense	probably benign	0.00
R6252:Syne2	UTSW	12	75969436	missense	probably benign	0.39
R6271:Syne2	UTSW	12	75890381	missense	probably damaging	1.00
R6320:Syne2	UTSW	12	76061650	missense	probably damaging	0.96
R6339:Syne2	UTSW	12	75989153	missense	probably benign	0.34
R6380:Syne2	UTSW	12	76104980	missense	probably damaging	0.98
R6394:Syne2	UTSW	12	75990495	missense	probably benign	0.09
R6419:Syne2	UTSW	12	76096966	missense	probably damaging	1.00
R6426:Syne2	UTSW	12	75923083	missense	probably null	0.97
R6434:Syne2	UTSW	12	76041456	missense	probably damaging	0.99
R6437:Syne2	UTSW	12	75990414	missense	possibly damaging	0.87
R6466:Syne2	UTSW	12	75943901	missense	probably damaging	0.97
R6501:Syne2	UTSW	12	76027847	splice site	probably null
R6552:Syne2	UTSW	12	75890241	missense	possibly damaging	0.89
R6744:Syne2	UTSW	12	76074447	missense	probably damaging	1.00
R6810:Syne2	UTSW	12	75942885	missense	probably benign	0.00
R6831:Syne2	UTSW	12	75966794	missense	probably benign	0.39
R6861:Syne2	UTSW	12	75909266	missense	probably damaging	1.00
R6875:Syne2	UTSW	12	76035630	missense	probably damaging	0.99
R6892:Syne2	UTSW	12	75962528	missense	probably damaging	0.98
R6899:Syne2	UTSW	12	76095729	splice site	probably null
R6906:Syne2	UTSW	12	75995986	missense	possibly damaging	0.93
R6909:Syne2	UTSW	12	76064195	missense	probably benign	0.04
R6925:Syne2	UTSW	12	75854132	missense	possibly damaging	0.58
R6949:Syne2	UTSW	12	75965997	missense	probably benign	0.00
R6952:Syne2	UTSW	12	75927431	missense	possibly damaging	0.76
R6996:Syne2	UTSW	12	76028012	missense	probably damaging	0.99
R7080:Syne2	UTSW	12	76052727	missense	probably benign	0.00
R7083:Syne2	UTSW	12	75943888	missense	probably damaging	1.00
R7090:Syne2	UTSW	12	75942351	missense	probably benign
R7144:Syne2	UTSW	12	76005378	missense	probably benign	0.03
R7154:Syne2	UTSW	12	76059457	missense	possibly damaging	0.63
R7177:Syne2	UTSW	12	75971880	nonsense	probably null
R7190:Syne2	UTSW	12	76066587	missense	probably benign	0.01
R7206:Syne2	UTSW	12	76004757	missense	probably benign	0.02
R7208:Syne2	UTSW	12	76031398	splice site	probably null
R7230:Syne2	UTSW	12	75933900	missense	probably benign	0.12
R7260:Syne2	UTSW	12	75945079	missense	probably damaging	1.00
R7272:Syne2	UTSW	12	76048643	missense	probably benign	0.00
R7296:Syne2	UTSW	12	76103036	missense	probably benign	0.00
R7322:Syne2	UTSW	12	75984024	missense	probably damaging	1.00
R7329:Syne2	UTSW	12	75966984	missense	probably benign	0.01
R7332:Syne2	UTSW	12	75967755	critical splice donor site	probably null
R7381:Syne2	UTSW	12	75926489	missense	probably benign	0.11
R7401:Syne2	UTSW	12	75967381	missense	probably damaging	0.98
R7403:Syne2	UTSW	12	75915246	missense	not run
R7429:Syne2	UTSW	12	75933996	missense	probably damaging	1.00
R7429:Syne2	UTSW	12	76040410	nonsense	probably null
R7430:Syne2	UTSW	12	75933996	missense	probably damaging	1.00
R7430:Syne2	UTSW	12	76040410	nonsense	probably null
R7438:Syne2	UTSW	12	76015563	missense	probably benign	0.04
R7447:Syne2	UTSW	12	76028079	missense	probably benign	0.01
R7466:Syne2	UTSW	12	76046186	missense	possibly damaging	0.92
R7493:Syne2	UTSW	12	75965880	missense	probably benign	0.00
R7502:Syne2	UTSW	12	76094326	missense	probably damaging	1.00
R7543:Syne2	UTSW	12	75906842	missense	possibly damaging	0.93
R7569:Syne2	UTSW	12	75927390	missense	probably benign	0.00
R7599:Syne2	UTSW	12	75966371	missense	probably benign	0.04
R7618:Syne2	UTSW	12	75945334	missense	probably benign	0.01
R7639:Syne2	UTSW	12	75934499	missense	probably damaging	1.00
R7698:Syne2	UTSW	12	75949064	missense	probably damaging	0.99
R7702:Syne2	UTSW	12	75990387	missense	probably benign	0.16
R7737:Syne2	UTSW	12	75942848	missense	probably damaging	1.00
R7742:Syne2	UTSW	12	76059435	missense	probably benign	0.02
R7753:Syne2	UTSW	12	76038923	missense	probably benign	0.43
R7755:Syne2	UTSW	12	75997407	missense	probably benign	0.19
R7757:Syne2	UTSW	12	76061779	missense	possibly damaging	0.87
R7790:Syne2	UTSW	12	75929103	splice site	probably null
R7808:Syne2	UTSW	12	75983727	splice site	probably null
R7809:Syne2	UTSW	12	75967456	missense	probably benign	0.00
R7811:Syne2	UTSW	12	75983727	splice site	probably null
R7834:Syne2	UTSW	12	75967247	missense	probably benign	0.00
R7853:Syne2	UTSW	12	76031504	missense	probably damaging	1.00
R7867:Syne2	UTSW	12	75983727	splice site	probably null
R7896:Syne2	UTSW	12	76035623	missense	probably damaging	0.99
R7903:Syne2	UTSW	12	76064184	missense	probably damaging	1.00
R7944:Syne2	UTSW	12	75904305	missense	probably damaging	0.98
R7945:Syne2	UTSW	12	75904305	missense	probably damaging	0.98
R7963:Syne2	UTSW	12	76020400	missense	probably benign	0.38
R7996:Syne2	UTSW	12	76004667	missense	probably damaging	1.00
R7998:Syne2	UTSW	12	76087858	missense	probably damaging	1.00
R8010:Syne2	UTSW	12	75930738	missense	probably benign	0.39
R8016:Syne2	UTSW	12	75942907	missense	probably benign	0.19
R8140:Syne2	UTSW	12	75912353	missense	possibly damaging	0.63
R8141:Syne2	UTSW	12	76061668	missense	possibly damaging	0.66
R8206:Syne2	UTSW	12	76015591	missense	probably benign	0.03
R8258:Syne2	UTSW	12	75949369	missense	possibly damaging	0.95
R8259:Syne2	UTSW	12	75949369	missense	possibly damaging	0.95
R8320:Syne2	UTSW	12	76103830	missense	probably damaging	0.99
R8464:Syne2	UTSW	12	75965772	missense	probably benign	0.39
R8465:Syne2	UTSW	12	75854124	missense	possibly damaging	0.92
R8486:Syne2	UTSW	12	76042107	nonsense	probably null
R8488:Syne2	UTSW	12	75965772	missense	probably benign	0.39
R8511:Syne2	UTSW	12	76008873	missense	probably benign	0.03
R8540:Syne2	UTSW	12	76094374	missense	probably damaging	1.00
R8711:Syne2	UTSW	12	76057484	missense	probably damaging	1.00
R8722:Syne2	UTSW	12	75925321	missense	probably benign	0.04
R8827:Syne2	UTSW	12	76048583	missense	probably benign	0.00
R8867:Syne2	UTSW	12	75942846	missense	probably damaging	1.00
R8878:Syne2	UTSW	12	75905293	missense	probably benign
R8924:Syne2	UTSW	12	75896670	missense	probably damaging	0.97
R8966:Syne2	UTSW	12	76099423	missense	probably damaging	1.00
R9007:Syne2	UTSW	12	76099450	missense	possibly damaging	0.82
R9019:Syne2	UTSW	12	75952844	missense	possibly damaging	0.93
R9057:Syne2	UTSW	12	75890393	missense	probably damaging	1.00
R9067:Syne2	UTSW	12	75904220	missense	probably damaging	1.00
R9081:Syne2	UTSW	12	75969516	nonsense	probably null
R9091:Syne2	UTSW	12	75931060	missense	probably damaging	1.00
R9123:Syne2	UTSW	12	75994064	missense	probably damaging	1.00
R9147:Syne2	UTSW	12	75890384	missense	probably damaging	1.00
R9148:Syne2	UTSW	12	75890384	missense	probably damaging	1.00
R9163:Syne2	UTSW	12	75962575	missense	possibly damaging	0.88
R9192:Syne2	UTSW	12	76109929	missense	probably damaging	1.00
R9248:Syne2	UTSW	12	76107456	intron	probably benign
R9270:Syne2	UTSW	12	75931060	missense	probably damaging	1.00
R9292:Syne2	UTSW	12	75951049	missense	probably benign
R9397:Syne2	UTSW	12	75994075	missense	possibly damaging	0.59
R9454:Syne2	UTSW	12	76020501	missense	probably damaging	0.99
R9454:Syne2	UTSW	12	76095070	nonsense	probably null
R9478:Syne2	UTSW	12	76107613	missense	probably damaging	0.96
R9492:Syne2	UTSW	12	75949065	missense	possibly damaging	0.77
R9573:Syne2	UTSW	12	75880360	missense	probably damaging	1.00
R9611:Syne2	UTSW	12	76033686	missense	probably benign	0.05
R9623:Syne2	UTSW	12	75939986	missense	probably benign	0.12
R9647:Syne2	UTSW	12	76105101	missense	possibly damaging	0.55
R9652:Syne2	UTSW	12	76054846	missense	probably benign	0.00
R9667:Syne2	UTSW	12	75880177	missense	probably damaging	1.00
R9701:Syne2	UTSW	12	75990423	missense	probably damaging	1.00
R9794:Syne2	UTSW	12	76000843	missense	probably benign	0.04
R9802:Syne2	UTSW	12	75990423	missense	probably damaging	1.00
X0019:Syne2	UTSW	12	75973287	missense	probably benign	0.41
X0026:Syne2	UTSW	12	76101016	missense	possibly damaging	0.78
X0061:Syne2	UTSW	12	75927511	critical splice donor site	probably null
X0066:Syne2	UTSW	12	76096927	missense	probably damaging	1.00
Z1176:Syne2	UTSW	12	75967541	missense	probably benign	0.01
Z1176:Syne2	UTSW	12	76040383	missense	possibly damaging	0.48
Z1177:Syne2	UTSW	12	75973423	missense	probably damaging	1.00
Z1177:Syne2	UTSW	12	76064138	missense	possibly damaging	0.51
Z1177:Syne2	UTSW	12	76097974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTATGTCTCAGTCATAGAGCCCTTGA -3'
(R):5'- TCCACTGTGATGCTCATACTCAGCTAA -3'

Sequencing Primer
(F):5'- TGGTCAAAAGAACTGGGGTG -3'
(R):5'- ATACTCAGCTAAGGCTCTGATGC -3'

Posted On

2013-06-12