Incidental Mutation 'R3806:Pcdha2'
ID473894
Institutional Source Beutler Lab
Gene Symbol Pcdha2
Ensembl Gene ENSMUSG00000104148
Gene Nameprotocadherin alpha 2
Synonyms
MMRRC Submission 040763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3806 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36939205-37187657 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 36941691 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 792 (E792*)
Ref Sequence ENSEMBL: ENSMUSP00000141355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115662] [ENSMUST00000192503] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115662
AA Change: E792*
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148
AA Change: E792*

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195590
AA Change: E792*
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148
AA Change: E792*

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap9 A G 5: 3,954,410 N108S probably benign Het
Ankmy1 A G 1: 92,883,758 I636T possibly damaging Het
Bbs9 T A 9: 22,887,630 D851E probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc175 T C 12: 72,180,824 T62A possibly damaging Het
Clcnka T C 4: 141,387,290 E615G probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpxm2 C T 7: 132,080,091 M236I probably benign Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Fam131a G A 16: 20,695,858 V70M probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxl15 G C 19: 46,329,452 R191P possibly damaging Het
Fcrlb T C 1: 170,907,614 T315A probably benign Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Gem C T 4: 11,705,965 Q18* probably null Het
Gm4788 T A 1: 139,753,035 K248N probably damaging Het
Hemk1 T A 9: 107,337,030 I68F probably damaging Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Ighv5-17 C A 12: 113,859,298 A68S probably benign Het
Ip6k3 T C 17: 27,145,000 H358R probably damaging Het
Itpr2 T C 6: 146,232,291 probably null Het
Kmt2a C T 9: 44,820,356 probably benign Het
Krt16 G T 11: 100,248,740 R51S unknown Het
Lamtor1 G A 7: 101,911,345 V156I probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Man1c1 A T 4: 134,703,351 L40Q probably damaging Het
Mgat4c A G 10: 102,388,360 N145S probably benign Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Muc5ac T C 7: 141,813,734 I2964T possibly damaging Het
Naip2 T A 13: 100,152,634 Q1196L possibly damaging Het
Nbas G A 12: 13,482,504 G1738S probably damaging Het
Nlrp5 A G 7: 23,404,846 E44G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr73 A G 2: 88,034,567 S191P possibly damaging Het
Otof T A 5: 30,386,499 probably null Het
Pcnx A G 12: 81,950,137 T936A possibly damaging Het
Pofut2 T C 10: 77,260,806 Y122H probably damaging Het
Psg16 A G 7: 17,090,684 E131G probably benign Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Rab6a A G 7: 100,608,224 M1V probably null Het
Ripk3 T C 14: 55,786,268 R29G probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Ruvbl2 A G 7: 45,422,190 V423A possibly damaging Het
Scgb2b18 T G 7: 33,173,138 M81L probably benign Het
Slc24a2 A T 4: 87,227,784 L11H possibly damaging Het
Slc4a1 T C 11: 102,357,193 E325G probably benign Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Them6 A G 15: 74,721,518 D75G probably damaging Het
Tmem5 A T 10: 122,081,609 V333E possibly damaging Het
Tmem57 C T 4: 134,830,580 M207I probably benign Het
Tnrc18 G A 5: 142,787,274 A417V unknown Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zbtb22 C T 17: 33,916,946 probably benign Het
Zfp235 A G 7: 24,140,621 D225G probably benign Het
Other mutations in Pcdha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03052:Pcdha2 UTSW 18 36941617 missense probably damaging 1.00
R3157:Pcdha2 UTSW 18 36940092 missense probably damaging 1.00
R3159:Pcdha2 UTSW 18 36941197 missense probably damaging 1.00
R3806:Pcdha2 UTSW 18 36939529 missense probably benign 0.02
R3815:Pcdha2 UTSW 18 36941695 missense probably benign
R3816:Pcdha2 UTSW 18 36941695 missense probably benign
R3937:Pcdha2 UTSW 18 36941323 missense probably benign 0.42
R3970:Pcdha2 UTSW 18 36940697 nonsense probably null
R4058:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4059:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4179:Pcdha2 UTSW 18 36941476 missense probably damaging 1.00
R4457:Pcdha2 UTSW 18 36940546 missense probably damaging 1.00
R4724:Pcdha2 UTSW 18 36940515 missense possibly damaging 0.88
R4812:Pcdha2 UTSW 18 36939808 missense probably benign
R4884:Pcdha2 UTSW 18 36940900 missense probably damaging 1.00
R5130:Pcdha2 UTSW 18 36940669 missense probably damaging 1.00
R5223:Pcdha2 UTSW 18 36940791 missense probably damaging 1.00
R5442:Pcdha2 UTSW 18 36939862 missense probably benign 0.14
R5460:Pcdha2 UTSW 18 36939421 missense probably damaging 1.00
R5493:Pcdha2 UTSW 18 36939509 missense probably damaging 0.98
R5946:Pcdha2 UTSW 18 36941106 missense probably damaging 0.96
R6054:Pcdha2 UTSW 18 36940804 missense probably damaging 1.00
R7378:Pcdha2 UTSW 18 36939385 missense possibly damaging 0.88
R7465:Pcdha2 UTSW 18 36940330 missense probably damaging 1.00
R7542:Pcdha2 UTSW 18 36940089 missense probably damaging 0.99
R7774:Pcdha2 UTSW 18 36941526 missense probably benign
R7953:Pcdha2 UTSW 18 36939526 missense probably benign 0.00
R8043:Pcdha2 UTSW 18 36939526 missense probably benign 0.00
R8048:Pcdha2 UTSW 18 36939460 missense probably damaging 1.00
R8371:Pcdha2 UTSW 18 36940263 missense possibly damaging 0.84
R8414:Pcdha2 UTSW 18 36941566 missense probably damaging 1.00
R8472:Pcdha2 UTSW 18 36941272 missense probably damaging 1.00
Z1088:Pcdha2 UTSW 18 36941121 missense probably damaging 1.00
Predicted Primers
Posted On2017-04-14