Incidental Mutation 'R0504:Mfng'
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene NameMFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsmanic fringe
MMRRC Submission 038699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0504 (G1)
Quality Score225
Status Validated
Chromosomal Location78755882-78773475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78757314 bp
Amino Acid Change Histidine to Glutamine at position 294 (H294Q)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
PDB Structure
Predicted Effect probably benign
Transcript: ENSMUST00000018313
AA Change: H294Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: H294Q

transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,270,860 probably benign Het
4931440F15Rik T C 11: 29,824,990 I156V probably damaging Het
Adamts6 T C 13: 104,426,930 probably benign Het
Adamts9 T A 6: 92,912,645 Y316F probably damaging Het
Agl A T 3: 116,786,784 F374I probably damaging Het
Akr1c19 A G 13: 4,236,251 T83A possibly damaging Het
Ankrd36 T A 11: 5,629,274 S179R probably damaging Het
Appbp2 A G 11: 85,191,687 S573P probably benign Het
Arid4a T A 12: 71,047,214 F254I probably damaging Het
Asna1 A C 8: 85,018,607 V277G probably damaging Het
Bin3 T C 14: 70,123,887 probably null Het
Bmi1 T C 2: 18,684,072 probably null Het
Bmper G T 9: 23,406,687 C534F probably damaging Het
Bora T A 14: 99,061,623 C205* probably null Het
Btnl2 A G 17: 34,358,117 E82G probably benign Het
Ccdc8 A T 7: 16,996,014 D476V unknown Het
Ccr3 C A 9: 124,029,441 T271K possibly damaging Het
Cd276 A G 9: 58,540,678 L23P possibly damaging Het
Cd3e T C 9: 45,002,254 Q61R probably benign Het
Cep97 A G 16: 55,905,779 S582P probably benign Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Chst1 A G 2: 92,613,824 N214D probably benign Het
Chuk T C 19: 44,081,938 probably benign Het
Col12a1 G A 9: 79,681,468 H1122Y possibly damaging Het
Cpne6 A G 14: 55,514,602 K272R probably damaging Het
Cpsf2 T A 12: 101,990,003 L355Q probably damaging Het
Cyp2c29 T A 19: 39,309,780 D256E probably benign Het
Daglb G A 5: 143,494,197 V420I probably benign Het
Ddx42 G T 11: 106,247,849 G825C probably benign Het
Dis3 T C 14: 99,081,390 probably benign Het
Dkk4 C T 8: 22,625,343 R70C probably damaging Het
Dock6 G T 9: 21,802,436 Q1933K probably damaging Het
Dpep2 T G 8: 105,989,988 Q186H probably benign Het
Dzip3 A C 16: 48,959,643 probably benign Het
Egflam T A 15: 7,222,758 I853F probably damaging Het
Fastkd5 A G 2: 130,615,917 I251T probably benign Het
Fbn2 T A 18: 58,039,460 D2091V possibly damaging Het
Fer1l4 C A 2: 156,052,195 V63L probably benign Het
Frem1 T A 4: 82,912,637 D2062V probably benign Het
Galnt6 A C 15: 100,696,657 probably benign Het
Gm10972 A T 3: 94,643,133 probably benign Het
Gm4846 G A 1: 166,491,545 T208I probably benign Het
Gorab A G 1: 163,386,605 L252P probably damaging Het
Gtsf2 A G 15: 103,444,561 C63R probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hmcn1 A T 1: 150,876,419 probably benign Het
Hormad2 A T 11: 4,408,833 H191Q possibly damaging Het
Hspa2 A T 12: 76,405,216 D228V probably damaging Het
Igfn1 A T 1: 135,968,529 M1433K probably benign Het
Il18 A G 9: 50,575,328 D19G probably damaging Het
Il1rl2 G A 1: 40,329,056 V129I probably benign Het
Inpp5b C A 4: 124,782,408 Y352* probably null Het
Insrr A T 3: 87,813,156 M1034L possibly damaging Het
Jmjd1c T C 10: 67,225,755 S1296P probably damaging Het
Kdm5b G T 1: 134,621,023 probably null Het
Krba1 C T 6: 48,416,254 T998I probably benign Het
L3mbtl4 A G 17: 68,777,912 N606S probably benign Het
Lonrf1 T A 8: 36,231,159 N395I possibly damaging Het
Lpp A G 16: 24,971,970 D393G probably damaging Het
Lrrc17 A G 5: 21,560,530 I3M probably benign Het
Lrrtm4 A T 6: 80,022,046 Q147L probably damaging Het
Map1a A G 2: 121,302,941 M1413V probably benign Het
Mapk8ip2 A G 15: 89,456,658 E102G possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mdn1 T C 4: 32,698,916 probably benign Het
Mical2 T A 7: 112,271,317 N4K probably benign Het
Mov10l1 T A 15: 88,998,839 V384E probably damaging Het
Myo18b A G 5: 112,873,576 probably benign Het
Nlrp1b T G 11: 71,182,415 I201L probably damaging Het
Nos2 C T 11: 78,940,077 P249L probably damaging Het
Notch4 A G 17: 34,575,091 T681A probably damaging Het
Nr1i3 C T 1: 171,217,236 probably benign Het
Obscn A G 11: 59,008,507 probably null Het
Olfr1024 T A 2: 85,904,686 M123L possibly damaging Het
Olfr1230 C T 2: 89,296,739 C177Y probably damaging Het
Olfr1248 A T 2: 89,618,094 Y33N probably damaging Het
Olfr237-ps1 A T 6: 43,153,461 H52L probably benign Het
Olfr328 C A 11: 58,551,636 C201F probably damaging Het
Olfr452 C T 6: 42,790,596 R186* probably null Het
Olfr517 C T 7: 108,868,850 M101I possibly damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr705 T A 7: 106,714,701 probably benign Het
Olfr881 A G 9: 37,993,142 T217A probably benign Het
Onecut2 A T 18: 64,340,749 I124F possibly damaging Het
Otol1 G A 3: 70,027,604 G310R probably damaging Het
Oxct2b T A 4: 123,116,840 S184R possibly damaging Het
Oxct2b ACTG A 4: 123,116,912 probably benign Het
P2rx6 A G 16: 17,567,427 probably benign Het
Pde4a A G 9: 21,204,403 N411S probably damaging Het
Phkb A T 8: 86,056,524 D983V probably benign Het
Piezo2 G A 18: 63,024,451 T2396I probably damaging Het
Pik3ap1 T A 19: 41,287,490 D717V probably damaging Het
Plce1 T A 19: 38,778,021 probably benign Het
Plekhg1 A G 10: 3,937,853 I261V probably damaging Het
Ppfia4 T C 1: 134,324,113 H441R probably damaging Het
Prpf8 T A 11: 75,501,942 probably benign Het
Ptn T A 6: 36,741,453 probably benign Het
Ptpn13 A G 5: 103,501,496 Y255C possibly damaging Het
Ptpn4 A G 1: 119,765,915 Y126H probably damaging Het
Ptprc T C 1: 138,088,697 N505D probably damaging Het
Ptprs T A 17: 56,454,220 I116F possibly damaging Het
Rab1a T G 11: 20,223,169 V90G probably damaging Het
Rcor1 T C 12: 111,101,668 V267A probably benign Het
Reep4 A G 14: 70,547,238 probably null Het
Rere T A 4: 150,615,322 probably benign Het
Rin3 T A 12: 102,387,564 Y743* probably null Het
Rprm A G 2: 54,085,055 S84P probably damaging Het
Sdhaf2 C T 19: 10,517,019 E109K probably damaging Het
Sec31b G T 19: 44,534,786 Q24K probably damaging Het
Sema5a T C 15: 32,574,803 probably benign Het
Sh3pxd2a T C 19: 47,267,747 Y844C probably damaging Het
Shmt2 A C 10: 127,520,072 N134K probably damaging Het
Slc9a8 C T 2: 167,424,205 A34V probably benign Het
Spidr A C 16: 16,140,072 S64A possibly damaging Het
Stk10 A G 11: 32,617,882 T895A probably benign Het
Syne2 A T 12: 76,033,591 probably benign Het
Szt2 T C 4: 118,372,952 probably null Het
Tecpr1 A T 5: 144,214,081 V303D probably damaging Het
Tet3 A G 6: 83,373,794 Y1048H probably damaging Het
Tfb2m A G 1: 179,545,831 C101R probably damaging Het
Tg T C 15: 66,682,404 V556A probably damaging Het
Thbs4 A C 13: 92,767,184 I441M probably benign Het
Thsd7a A T 6: 12,379,594 Y944N probably damaging Het
Tm9sf3 C A 19: 41,247,892 probably benign Het
Tmem145 T C 7: 25,311,362 F359S probably damaging Het
Ttc21b C T 2: 66,222,798 probably benign Het
Ttn A G 2: 76,749,536 V23671A probably damaging Het
Txnl4b T C 8: 109,571,471 I78T probably benign Het
Ubr4 C A 4: 139,406,578 L762I probably damaging Het
Ubr4 T C 4: 139,480,838 probably null Het
Ugt1a8 C T 1: 88,088,357 P164L probably damaging Het
Unc13b T C 4: 43,263,559 S1594P probably damaging Het
Utrn A T 10: 12,402,895 F912I probably benign Het
Vat1l T C 8: 114,236,579 probably benign Het
Vmn1r50 T A 6: 90,107,881 S203T probably damaging Het
Vmn2r4 A T 3: 64,389,363 L667Q probably damaging Het
Vmn2r66 T G 7: 85,006,815 Q331P probably damaging Het
Wdsub1 A T 2: 59,878,325 V68D possibly damaging Het
Wnk2 C G 13: 49,085,394 A564P possibly damaging Het
Wnk2 T A 13: 49,085,396 K563M probably damaging Het
Zan T A 5: 137,470,318 H297L probably damaging Het
Zfp426 A T 9: 20,470,031 H539Q probably damaging Het
Zfp488 T A 14: 33,970,540 N222I probably damaging Het
Zfp536 T A 7: 37,568,818 H391L probably damaging Het
Zp1 T A 19: 10,916,207 N31I probably damaging Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78764437 missense possibly damaging 0.79
R1905:Mfng UTSW 15 78773086 missense probably damaging 1.00
R3871:Mfng UTSW 15 78756621 missense probably damaging 1.00
R4845:Mfng UTSW 15 78764388 missense probably benign
R4872:Mfng UTSW 15 78764388 missense probably benign
R4874:Mfng UTSW 15 78764388 missense probably benign
R4925:Mfng UTSW 15 78764388 missense probably benign
R4934:Mfng UTSW 15 78764388 missense probably benign
R5006:Mfng UTSW 15 78764388 missense probably benign
R5029:Mfng UTSW 15 78764388 missense probably benign
R5048:Mfng UTSW 15 78764388 missense probably benign
R5064:Mfng UTSW 15 78764388 missense probably benign
R5067:Mfng UTSW 15 78764388 missense probably benign
R5143:Mfng UTSW 15 78764388 missense probably benign
R5145:Mfng UTSW 15 78764388 missense probably benign
R5146:Mfng UTSW 15 78764388 missense probably benign
R5266:Mfng UTSW 15 78764388 missense probably benign
R5969:Mfng UTSW 15 78764382 missense possibly damaging 0.94
R6012:Mfng UTSW 15 78756640 missense probably damaging 1.00
R6654:Mfng UTSW 15 78759339 missense probably damaging 1.00
R7211:Mfng UTSW 15 78773068 missense probably benign 0.12
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tttcttccctacactgagcc -3'
Posted On2013-06-12