Incidental Mutation 'R0759:Gm43434'
ID474007
Institutional Source Beutler Lab
Gene Symbol Gm43434
Ensembl Gene
Gene Namepredicted gene 43434
Synonyms
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54128298-54146287 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to G at 54145495 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000103685]
Predicted Effect probably benign
Transcript: ENSMUST00000103685
SMART Domains Protein: ENSMUSP00000100458
Gene: ENSMUSG00000076873

DomainStartEndE-ValueType
IGv 35 113 2.06e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196615
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Predicted Primers
Posted On2017-04-14