Incidental Mutation 'R0759:Amdhd2'
ID474009
Institutional Source Beutler Lab
Gene Symbol Amdhd2
Ensembl Gene ENSMUSG00000036820
Gene Nameamidohydrolase domain containing 2
Synonyms
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24155833-24163766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24161613 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 119 (C119F)
Ref Sequence ENSEMBL: ENSMUSP00000120520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024932] [ENSMUST00000040735] [ENSMUST00000098862] [ENSMUST00000129523] [ENSMUST00000148541] [ENSMUST00000150647] [ENSMUST00000202853]
Predicted Effect probably benign
Transcript: ENSMUST00000024932
SMART Domains Protein: ENSMUSP00000024932
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 14 79 5.6e-17 PFAM
Pfam:ATP-synt_C 90 155 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040735
SMART Domains Protein: ENSMUSP00000036141
Gene: ENSMUSG00000036820

DomainStartEndE-ValueType
Pfam:Amidohydro_1 62 401 7.2e-18 PFAM
Pfam:Amidohydro_3 327 404 5.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098862
SMART Domains Protein: ENSMUSP00000111059
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 15 77 1.1e-14 PFAM
Pfam:ATP-synt_C 92 153 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129523
AA Change: C119F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120520
Gene: ENSMUSG00000036820
AA Change: C119F

DomainStartEndE-ValueType
Pfam:Amidohydro_5 1 71 1.5e-7 PFAM
Pfam:Amidohydro_4 22 176 2.5e-9 PFAM
Pfam:Amidohydro_1 27 134 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132944
Predicted Effect probably benign
Transcript: ENSMUST00000138685
SMART Domains Protein: ENSMUSP00000122523
Gene: ENSMUSG00000036820

DomainStartEndE-ValueType
Pfam:Amidohydro_1 5 57 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148541
SMART Domains Protein: ENSMUSP00000121464
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 14 79 5.2e-17 PFAM
Pfam:ATP-synt_C 90 150 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150647
SMART Domains Protein: ENSMUSP00000122843
Gene: ENSMUSG00000024121

DomainStartEndE-ValueType
Pfam:ATP-synt_C 32 85 5.1e-15 PFAM
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156061
Predicted Effect probably benign
Transcript: ENSMUST00000202853
SMART Domains Protein: ENSMUSP00000144462
Gene: ENSMUSG00000107169

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
Blast:TLDc 283 321 4e-13 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Amdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Amdhd2 APN 17 24163600 missense probably benign 0.38
IGL01868:Amdhd2 APN 17 24157530 missense probably damaging 1.00
IGL02889:Amdhd2 APN 17 24157787 missense probably damaging 1.00
IGL03127:Amdhd2 APN 17 24157738 critical splice donor site probably null
R0619:Amdhd2 UTSW 17 24156588 missense possibly damaging 0.65
R0970:Amdhd2 UTSW 17 24156570 critical splice donor site probably null
R1657:Amdhd2 UTSW 17 24156055 missense probably damaging 1.00
R1929:Amdhd2 UTSW 17 24157886 splice site probably null
R2080:Amdhd2 UTSW 17 24156604 missense probably benign 0.00
R2127:Amdhd2 UTSW 17 24158308 critical splice donor site probably null
R2871:Amdhd2 UTSW 17 24157855 unclassified probably benign
R4419:Amdhd2 UTSW 17 24158678 missense probably benign 0.31
R5681:Amdhd2 UTSW 17 24156040 missense probably damaging 1.00
R6315:Amdhd2 UTSW 17 24158356 missense probably benign 0.00
R6413:Amdhd2 UTSW 17 24158316 missense probably damaging 1.00
R7402:Amdhd2 UTSW 17 24161683 missense
R8276:Amdhd2 UTSW 17 24163600 missense probably damaging 0.98
Predicted Primers
Posted On2017-04-14