Mutagenetix > Incidental Mutation

Incidental Mutation 'R0504:Piezo2'

47414

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

038699-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0504 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63024451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 2396 (T2396I)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: T2396I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: T2396I

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132576

Predicted Effect

unknown
Transcript: ENSMUST00000137141
AA Change: T218I

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482
AA Change: T218I

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.4000

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

99% (145/147)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 145 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	G	4: 103,270,860		probably benign	Het
4931440F15Rik	T	C	11: 29,824,990	I156V	probably damaging	Het
Adamts6	T	C	13: 104,426,930		probably benign	Het
Adamts9	T	A	6: 92,912,645	Y316F	probably damaging	Het
Agl	A	T	3: 116,786,784	F374I	probably damaging	Het
Akr1c19	A	G	13: 4,236,251	T83A	possibly damaging	Het
Ankrd36	T	A	11: 5,629,274	S179R	probably damaging	Het
Appbp2	A	G	11: 85,191,687	S573P	probably benign	Het
Arid4a	T	A	12: 71,047,214	F254I	probably damaging	Het
Asna1	A	C	8: 85,018,607	V277G	probably damaging	Het
Bin3	T	C	14: 70,123,887		probably null	Het
Bmi1	T	C	2: 18,684,072		probably null	Het
Bmper	G	T	9: 23,406,687	C534F	probably damaging	Het
Bora	T	A	14: 99,061,623	C205*	probably null	Het
Btnl2	A	G	17: 34,358,117	E82G	probably benign	Het
Ccdc8	A	T	7: 16,996,014	D476V	unknown	Het
Ccr3	C	A	9: 124,029,441	T271K	possibly damaging	Het
Cd276	A	G	9: 58,540,678	L23P	possibly damaging	Het
Cd3e	T	C	9: 45,002,254	Q61R	probably benign	Het
Cep97	A	G	16: 55,905,779	S582P	probably benign	Het
Chml	A	T	1: 175,687,182	M391K	probably damaging	Het
Chst1	A	G	2: 92,613,824	N214D	probably benign	Het
Chuk	T	C	19: 44,081,938		probably benign	Het
Col12a1	G	A	9: 79,681,468	H1122Y	possibly damaging	Het
Cpne6	A	G	14: 55,514,602	K272R	probably damaging	Het
Cpsf2	T	A	12: 101,990,003	L355Q	probably damaging	Het
Cyp2c29	T	A	19: 39,309,780	D256E	probably benign	Het
Daglb	G	A	5: 143,494,197	V420I	probably benign	Het
Ddx42	G	T	11: 106,247,849	G825C	probably benign	Het
Dis3	T	C	14: 99,081,390		probably benign	Het
Dkk4	C	T	8: 22,625,343	R70C	probably damaging	Het
Dock6	G	T	9: 21,802,436	Q1933K	probably damaging	Het
Dpep2	T	G	8: 105,989,988	Q186H	probably benign	Het
Dzip3	A	C	16: 48,959,643		probably benign	Het
Egflam	T	A	15: 7,222,758	I853F	probably damaging	Het
Fastkd5	A	G	2: 130,615,917	I251T	probably benign	Het
Fbn2	T	A	18: 58,039,460	D2091V	possibly damaging	Het
Fer1l4	C	A	2: 156,052,195	V63L	probably benign	Het
Frem1	T	A	4: 82,912,637	D2062V	probably benign	Het
Galnt6	A	C	15: 100,696,657		probably benign	Het
Gm10972	A	T	3: 94,643,133		probably benign	Het
Gm4846	G	A	1: 166,491,545	T208I	probably benign	Het
Gorab	A	G	1: 163,386,605	L252P	probably damaging	Het
Gtsf2	A	G	15: 103,444,561	C63R	probably damaging	Het
Hal	T	C	10: 93,489,174	V15A	probably damaging	Het
Hmcn1	A	T	1: 150,876,419		probably benign	Het
Hormad2	A	T	11: 4,408,833	H191Q	possibly damaging	Het
Hspa2	A	T	12: 76,405,216	D228V	probably damaging	Het
Igfn1	A	T	1: 135,968,529	M1433K	probably benign	Het
Il18	A	G	9: 50,575,328	D19G	probably damaging	Het
Il1rl2	G	A	1: 40,329,056	V129I	probably benign	Het
Inpp5b	C	A	4: 124,782,408	Y352*	probably null	Het
Insrr	A	T	3: 87,813,156	M1034L	possibly damaging	Het
Jmjd1c	T	C	10: 67,225,755	S1296P	probably damaging	Het
Kdm5b	G	T	1: 134,621,023		probably null	Het
Krba1	C	T	6: 48,416,254	T998I	probably benign	Het
L3mbtl4	A	G	17: 68,777,912	N606S	probably benign	Het
Lonrf1	T	A	8: 36,231,159	N395I	possibly damaging	Het
Lpp	A	G	16: 24,971,970	D393G	probably damaging	Het
Lrrc17	A	G	5: 21,560,530	I3M	probably benign	Het
Lrrtm4	A	T	6: 80,022,046	Q147L	probably damaging	Het
Map1a	A	G	2: 121,302,941	M1413V	probably benign	Het
Mapk8ip2	A	G	15: 89,456,658	E102G	possibly damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mdn1	T	C	4: 32,698,916		probably benign	Het
Mfng	A	C	15: 78,757,314	H294Q	probably benign	Het
Mical2	T	A	7: 112,271,317	N4K	probably benign	Het
Mov10l1	T	A	15: 88,998,839	V384E	probably damaging	Het
Myo18b	A	G	5: 112,873,576		probably benign	Het
Nlrp1b	T	G	11: 71,182,415	I201L	probably damaging	Het
Nos2	C	T	11: 78,940,077	P249L	probably damaging	Het
Notch4	A	G	17: 34,575,091	T681A	probably damaging	Het
Nr1i3	C	T	1: 171,217,236		probably benign	Het
Obscn	A	G	11: 59,008,507		probably null	Het
Olfr1024	T	A	2: 85,904,686	M123L	possibly damaging	Het
Olfr1230	C	T	2: 89,296,739	C177Y	probably damaging	Het
Olfr1248	A	T	2: 89,618,094	Y33N	probably damaging	Het
Olfr237-ps1	A	T	6: 43,153,461	H52L	probably benign	Het
Olfr328	C	A	11: 58,551,636	C201F	probably damaging	Het
Olfr452	C	T	6: 42,790,596	R186*	probably null	Het
Olfr517	C	T	7: 108,868,850	M101I	possibly damaging	Het
Olfr654	C	T	7: 104,588,475	R224*	probably null	Het
Olfr705	T	A	7: 106,714,701		probably benign	Het
Olfr881	A	G	9: 37,993,142	T217A	probably benign	Het
Onecut2	A	T	18: 64,340,749	I124F	possibly damaging	Het
Otol1	G	A	3: 70,027,604	G310R	probably damaging	Het
Oxct2b	T	A	4: 123,116,840	S184R	possibly damaging	Het
Oxct2b	ACTG	A	4: 123,116,912		probably benign	Het
P2rx6	A	G	16: 17,567,427		probably benign	Het
Pde4a	A	G	9: 21,204,403	N411S	probably damaging	Het
Phkb	A	T	8: 86,056,524	D983V	probably benign	Het
Pik3ap1	T	A	19: 41,287,490	D717V	probably damaging	Het
Plce1	T	A	19: 38,778,021		probably benign	Het
Plekhg1	A	G	10: 3,937,853	I261V	probably damaging	Het
Ppfia4	T	C	1: 134,324,113	H441R	probably damaging	Het
Prpf8	T	A	11: 75,501,942		probably benign	Het
Ptn	T	A	6: 36,741,453		probably benign	Het
Ptpn13	A	G	5: 103,501,496	Y255C	possibly damaging	Het
Ptpn4	A	G	1: 119,765,915	Y126H	probably damaging	Het
Ptprc	T	C	1: 138,088,697	N505D	probably damaging	Het
Ptprs	T	A	17: 56,454,220	I116F	possibly damaging	Het
Rab1a	T	G	11: 20,223,169	V90G	probably damaging	Het
Rcor1	T	C	12: 111,101,668	V267A	probably benign	Het
Reep4	A	G	14: 70,547,238		probably null	Het
Rere	T	A	4: 150,615,322		probably benign	Het
Rin3	T	A	12: 102,387,564	Y743*	probably null	Het
Rprm	A	G	2: 54,085,055	S84P	probably damaging	Het
Sdhaf2	C	T	19: 10,517,019	E109K	probably damaging	Het
Sec31b	G	T	19: 44,534,786	Q24K	probably damaging	Het
Sema5a	T	C	15: 32,574,803		probably benign	Het
Sh3pxd2a	T	C	19: 47,267,747	Y844C	probably damaging	Het
Shmt2	A	C	10: 127,520,072	N134K	probably damaging	Het
Slc9a8	C	T	2: 167,424,205	A34V	probably benign	Het
Spidr	A	C	16: 16,140,072	S64A	possibly damaging	Het
Stk10	A	G	11: 32,617,882	T895A	probably benign	Het
Syne2	A	T	12: 76,033,591		probably benign	Het
Szt2	T	C	4: 118,372,952		probably null	Het
Tecpr1	A	T	5: 144,214,081	V303D	probably damaging	Het
Tet3	A	G	6: 83,373,794	Y1048H	probably damaging	Het
Tfb2m	A	G	1: 179,545,831	C101R	probably damaging	Het
Tg	T	C	15: 66,682,404	V556A	probably damaging	Het
Thbs4	A	C	13: 92,767,184	I441M	probably benign	Het
Thsd7a	A	T	6: 12,379,594	Y944N	probably damaging	Het
Tm9sf3	C	A	19: 41,247,892		probably benign	Het
Tmem145	T	C	7: 25,311,362	F359S	probably damaging	Het
Ttc21b	C	T	2: 66,222,798		probably benign	Het
Ttn	A	G	2: 76,749,536	V23671A	probably damaging	Het
Txnl4b	T	C	8: 109,571,471	I78T	probably benign	Het
Ubr4	C	A	4: 139,406,578	L762I	probably damaging	Het
Ubr4	T	C	4: 139,480,838		probably null	Het
Ugt1a8	C	T	1: 88,088,357	P164L	probably damaging	Het
Unc13b	T	C	4: 43,263,559	S1594P	probably damaging	Het
Utrn	A	T	10: 12,402,895	F912I	probably benign	Het
Vat1l	T	C	8: 114,236,579		probably benign	Het
Vmn1r50	T	A	6: 90,107,881	S203T	probably damaging	Het
Vmn2r4	A	T	3: 64,389,363	L667Q	probably damaging	Het
Vmn2r66	T	G	7: 85,006,815	Q331P	probably damaging	Het
Wdsub1	A	T	2: 59,878,325	V68D	possibly damaging	Het
Wnk2	C	G	13: 49,085,394	A564P	possibly damaging	Het
Wnk2	T	A	13: 49,085,396	K563M	probably damaging	Het
Zan	T	A	5: 137,470,318	H297L	probably damaging	Het
Zfp426	A	T	9: 20,470,031	H539Q	probably damaging	Het
Zfp488	T	A	14: 33,970,540	N222I	probably damaging	Het
Zfp536	T	A	7: 37,568,818	H391L	probably damaging	Het
Zp1	T	A	19: 10,916,207	N31I	probably damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8810:Piezo2	UTSW	18	63114963	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCCAACATTGTAAGAGCTTCAGGG -3'
(R):5'- TCATGATGACCGAGGATGCTCCAG -3'

Sequencing Primer
(F):5'- GGTGCCTTACGCCCTTG -3'
(R):5'- GGGCTGTCTGCCTATCAAAT -3'

Posted On

2013-06-12