Incidental Mutation 'R0504:Piezo2'
ID47414
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 038699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0504 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63024451 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2396 (T2396I)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480]
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: T2396I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: T2396I

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132576
Predicted Effect unknown
Transcript: ENSMUST00000137141
AA Change: T218I
SMART Domains Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482
AA Change: T218I

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 235 409 4.6e-78 PFAM
Meta Mutation Damage Score 0.4000 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,270,860 probably benign Het
4931440F15Rik T C 11: 29,824,990 I156V probably damaging Het
Adamts6 T C 13: 104,426,930 probably benign Het
Adamts9 T A 6: 92,912,645 Y316F probably damaging Het
Agl A T 3: 116,786,784 F374I probably damaging Het
Akr1c19 A G 13: 4,236,251 T83A possibly damaging Het
Ankrd36 T A 11: 5,629,274 S179R probably damaging Het
Appbp2 A G 11: 85,191,687 S573P probably benign Het
Arid4a T A 12: 71,047,214 F254I probably damaging Het
Asna1 A C 8: 85,018,607 V277G probably damaging Het
Bin3 T C 14: 70,123,887 probably null Het
Bmi1 T C 2: 18,684,072 probably null Het
Bmper G T 9: 23,406,687 C534F probably damaging Het
Bora T A 14: 99,061,623 C205* probably null Het
Btnl2 A G 17: 34,358,117 E82G probably benign Het
Ccdc8 A T 7: 16,996,014 D476V unknown Het
Ccr3 C A 9: 124,029,441 T271K possibly damaging Het
Cd276 A G 9: 58,540,678 L23P possibly damaging Het
Cd3e T C 9: 45,002,254 Q61R probably benign Het
Cep97 A G 16: 55,905,779 S582P probably benign Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Chst1 A G 2: 92,613,824 N214D probably benign Het
Chuk T C 19: 44,081,938 probably benign Het
Col12a1 G A 9: 79,681,468 H1122Y possibly damaging Het
Cpne6 A G 14: 55,514,602 K272R probably damaging Het
Cpsf2 T A 12: 101,990,003 L355Q probably damaging Het
Cyp2c29 T A 19: 39,309,780 D256E probably benign Het
Daglb G A 5: 143,494,197 V420I probably benign Het
Ddx42 G T 11: 106,247,849 G825C probably benign Het
Dis3 T C 14: 99,081,390 probably benign Het
Dkk4 C T 8: 22,625,343 R70C probably damaging Het
Dock6 G T 9: 21,802,436 Q1933K probably damaging Het
Dpep2 T G 8: 105,989,988 Q186H probably benign Het
Dzip3 A C 16: 48,959,643 probably benign Het
Egflam T A 15: 7,222,758 I853F probably damaging Het
Fastkd5 A G 2: 130,615,917 I251T probably benign Het
Fbn2 T A 18: 58,039,460 D2091V possibly damaging Het
Fer1l4 C A 2: 156,052,195 V63L probably benign Het
Frem1 T A 4: 82,912,637 D2062V probably benign Het
Galnt6 A C 15: 100,696,657 probably benign Het
Gm10972 A T 3: 94,643,133 probably benign Het
Gm4846 G A 1: 166,491,545 T208I probably benign Het
Gorab A G 1: 163,386,605 L252P probably damaging Het
Gtsf2 A G 15: 103,444,561 C63R probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hmcn1 A T 1: 150,876,419 probably benign Het
Hormad2 A T 11: 4,408,833 H191Q possibly damaging Het
Hspa2 A T 12: 76,405,216 D228V probably damaging Het
Igfn1 A T 1: 135,968,529 M1433K probably benign Het
Il18 A G 9: 50,575,328 D19G probably damaging Het
Il1rl2 G A 1: 40,329,056 V129I probably benign Het
Inpp5b C A 4: 124,782,408 Y352* probably null Het
Insrr A T 3: 87,813,156 M1034L possibly damaging Het
Jmjd1c T C 10: 67,225,755 S1296P probably damaging Het
Kdm5b G T 1: 134,621,023 probably null Het
Krba1 C T 6: 48,416,254 T998I probably benign Het
L3mbtl4 A G 17: 68,777,912 N606S probably benign Het
Lonrf1 T A 8: 36,231,159 N395I possibly damaging Het
Lpp A G 16: 24,971,970 D393G probably damaging Het
Lrrc17 A G 5: 21,560,530 I3M probably benign Het
Lrrtm4 A T 6: 80,022,046 Q147L probably damaging Het
Map1a A G 2: 121,302,941 M1413V probably benign Het
Mapk8ip2 A G 15: 89,456,658 E102G possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mdn1 T C 4: 32,698,916 probably benign Het
Mfng A C 15: 78,757,314 H294Q probably benign Het
Mical2 T A 7: 112,271,317 N4K probably benign Het
Mov10l1 T A 15: 88,998,839 V384E probably damaging Het
Myo18b A G 5: 112,873,576 probably benign Het
Nlrp1b T G 11: 71,182,415 I201L probably damaging Het
Nos2 C T 11: 78,940,077 P249L probably damaging Het
Notch4 A G 17: 34,575,091 T681A probably damaging Het
Nr1i3 C T 1: 171,217,236 probably benign Het
Obscn A G 11: 59,008,507 probably null Het
Olfr1024 T A 2: 85,904,686 M123L possibly damaging Het
Olfr1230 C T 2: 89,296,739 C177Y probably damaging Het
Olfr1248 A T 2: 89,618,094 Y33N probably damaging Het
Olfr237-ps1 A T 6: 43,153,461 H52L probably benign Het
Olfr328 C A 11: 58,551,636 C201F probably damaging Het
Olfr452 C T 6: 42,790,596 R186* probably null Het
Olfr517 C T 7: 108,868,850 M101I possibly damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr705 T A 7: 106,714,701 probably benign Het
Olfr881 A G 9: 37,993,142 T217A probably benign Het
Onecut2 A T 18: 64,340,749 I124F possibly damaging Het
Otol1 G A 3: 70,027,604 G310R probably damaging Het
Oxct2b T A 4: 123,116,840 S184R possibly damaging Het
Oxct2b ACTG A 4: 123,116,912 probably benign Het
P2rx6 A G 16: 17,567,427 probably benign Het
Pde4a A G 9: 21,204,403 N411S probably damaging Het
Phkb A T 8: 86,056,524 D983V probably benign Het
Pik3ap1 T A 19: 41,287,490 D717V probably damaging Het
Plce1 T A 19: 38,778,021 probably benign Het
Plekhg1 A G 10: 3,937,853 I261V probably damaging Het
Ppfia4 T C 1: 134,324,113 H441R probably damaging Het
Prpf8 T A 11: 75,501,942 probably benign Het
Ptn T A 6: 36,741,453 probably benign Het
Ptpn13 A G 5: 103,501,496 Y255C possibly damaging Het
Ptpn4 A G 1: 119,765,915 Y126H probably damaging Het
Ptprc T C 1: 138,088,697 N505D probably damaging Het
Ptprs T A 17: 56,454,220 I116F possibly damaging Het
Rab1a T G 11: 20,223,169 V90G probably damaging Het
Rcor1 T C 12: 111,101,668 V267A probably benign Het
Reep4 A G 14: 70,547,238 probably null Het
Rere T A 4: 150,615,322 probably benign Het
Rin3 T A 12: 102,387,564 Y743* probably null Het
Rprm A G 2: 54,085,055 S84P probably damaging Het
Sdhaf2 C T 19: 10,517,019 E109K probably damaging Het
Sec31b G T 19: 44,534,786 Q24K probably damaging Het
Sema5a T C 15: 32,574,803 probably benign Het
Sh3pxd2a T C 19: 47,267,747 Y844C probably damaging Het
Shmt2 A C 10: 127,520,072 N134K probably damaging Het
Slc9a8 C T 2: 167,424,205 A34V probably benign Het
Spidr A C 16: 16,140,072 S64A possibly damaging Het
Stk10 A G 11: 32,617,882 T895A probably benign Het
Syne2 A T 12: 76,033,591 probably benign Het
Szt2 T C 4: 118,372,952 probably null Het
Tecpr1 A T 5: 144,214,081 V303D probably damaging Het
Tet3 A G 6: 83,373,794 Y1048H probably damaging Het
Tfb2m A G 1: 179,545,831 C101R probably damaging Het
Tg T C 15: 66,682,404 V556A probably damaging Het
Thbs4 A C 13: 92,767,184 I441M probably benign Het
Thsd7a A T 6: 12,379,594 Y944N probably damaging Het
Tm9sf3 C A 19: 41,247,892 probably benign Het
Tmem145 T C 7: 25,311,362 F359S probably damaging Het
Ttc21b C T 2: 66,222,798 probably benign Het
Ttn A G 2: 76,749,536 V23671A probably damaging Het
Txnl4b T C 8: 109,571,471 I78T probably benign Het
Ubr4 C A 4: 139,406,578 L762I probably damaging Het
Ubr4 T C 4: 139,480,838 probably null Het
Ugt1a8 C T 1: 88,088,357 P164L probably damaging Het
Unc13b T C 4: 43,263,559 S1594P probably damaging Het
Utrn A T 10: 12,402,895 F912I probably benign Het
Vat1l T C 8: 114,236,579 probably benign Het
Vmn1r50 T A 6: 90,107,881 S203T probably damaging Het
Vmn2r4 A T 3: 64,389,363 L667Q probably damaging Het
Vmn2r66 T G 7: 85,006,815 Q331P probably damaging Het
Wdsub1 A T 2: 59,878,325 V68D possibly damaging Het
Wnk2 C G 13: 49,085,394 A564P possibly damaging Het
Wnk2 T A 13: 49,085,396 K563M probably damaging Het
Zan T A 5: 137,470,318 H297L probably damaging Het
Zfp426 A T 9: 20,470,031 H539Q probably damaging Het
Zfp488 T A 14: 33,970,540 N222I probably damaging Het
Zfp536 T A 7: 37,568,818 H391L probably damaging Het
Zp1 T A 19: 10,916,207 N31I probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
R7829:Piezo2 UTSW 18 63113876 critical splice donor site probably null
R7835:Piezo2 UTSW 18 63082945 missense probably benign 0.12
R8014:Piezo2 UTSW 18 63083200 missense probably benign 0.02
R8055:Piezo2 UTSW 18 63042811 missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63030466 missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63075730 missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63012786 missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63084688 missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63045540 missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63146802 missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63092900 nonsense probably null
R8708:Piezo2 UTSW 18 63093015 missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63109885 missense probably benign
R8727:Piezo2 UTSW 18 63109885 missense probably benign
R8810:Piezo2 UTSW 18 63114963 missense probably benign 0.41
R8900:Piezo2 UTSW 18 63115025 missense probably benign 0.04
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCAACATTGTAAGAGCTTCAGGG -3'
(R):5'- TCATGATGACCGAGGATGCTCCAG -3'

Sequencing Primer
(F):5'- GGTGCCTTACGCCCTTG -3'
(R):5'- GGGCTGTCTGCCTATCAAAT -3'
Posted On2013-06-12