Incidental Mutation 'R0504:Cyp2c29'
Institutional Source Beutler Lab
Gene Symbol Cyp2c29
Ensembl Gene ENSMUSG00000003053
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 29
SynonymsAh-2, Cyp2c, P450-2C, Ahh-1, AHOHase, AHOH
MMRRC Submission 038699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0504 (G1)
Quality Score225
Status Validated
Chromosomal Location39269405-39330713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39309780 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 256 (D256E)
Ref Sequence ENSEMBL: ENSMUSP00000003137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003137] [ENSMUST00000176624] [ENSMUST00000177087]
Predicted Effect probably benign
Transcript: ENSMUST00000003137
AA Change: D256E

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003137
Gene: ENSMUSG00000003053
AA Change: D256E

low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 487 5.4e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176624
AA Change: D217E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135863
Gene: ENSMUSG00000003053
AA Change: D217E

Pfam:p450 12 448 2.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177087
SMART Domains Protein: ENSMUSP00000135839
Gene: ENSMUSG00000003053

low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 118 8.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (145/147)
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A G 4: 103,270,860 probably benign Het
4931440F15Rik T C 11: 29,824,990 I156V probably damaging Het
Adamts6 T C 13: 104,426,930 probably benign Het
Adamts9 T A 6: 92,912,645 Y316F probably damaging Het
Agl A T 3: 116,786,784 F374I probably damaging Het
Akr1c19 A G 13: 4,236,251 T83A possibly damaging Het
Ankrd36 T A 11: 5,629,274 S179R probably damaging Het
Appbp2 A G 11: 85,191,687 S573P probably benign Het
Arid4a T A 12: 71,047,214 F254I probably damaging Het
Asna1 A C 8: 85,018,607 V277G probably damaging Het
Bin3 T C 14: 70,123,887 probably null Het
Bmi1 T C 2: 18,684,072 probably null Het
Bmper G T 9: 23,406,687 C534F probably damaging Het
Bora T A 14: 99,061,623 C205* probably null Het
Btnl2 A G 17: 34,358,117 E82G probably benign Het
Ccdc8 A T 7: 16,996,014 D476V unknown Het
Ccr3 C A 9: 124,029,441 T271K possibly damaging Het
Cd276 A G 9: 58,540,678 L23P possibly damaging Het
Cd3e T C 9: 45,002,254 Q61R probably benign Het
Cep97 A G 16: 55,905,779 S582P probably benign Het
Chml A T 1: 175,687,182 M391K probably damaging Het
Chst1 A G 2: 92,613,824 N214D probably benign Het
Chuk T C 19: 44,081,938 probably benign Het
Col12a1 G A 9: 79,681,468 H1122Y possibly damaging Het
Cpne6 A G 14: 55,514,602 K272R probably damaging Het
Cpsf2 T A 12: 101,990,003 L355Q probably damaging Het
Daglb G A 5: 143,494,197 V420I probably benign Het
Ddx42 G T 11: 106,247,849 G825C probably benign Het
Dis3 T C 14: 99,081,390 probably benign Het
Dkk4 C T 8: 22,625,343 R70C probably damaging Het
Dock6 G T 9: 21,802,436 Q1933K probably damaging Het
Dpep2 T G 8: 105,989,988 Q186H probably benign Het
Dzip3 A C 16: 48,959,643 probably benign Het
Egflam T A 15: 7,222,758 I853F probably damaging Het
Fastkd5 A G 2: 130,615,917 I251T probably benign Het
Fbn2 T A 18: 58,039,460 D2091V possibly damaging Het
Fer1l4 C A 2: 156,052,195 V63L probably benign Het
Frem1 T A 4: 82,912,637 D2062V probably benign Het
Galnt6 A C 15: 100,696,657 probably benign Het
Gm10972 A T 3: 94,643,133 probably benign Het
Gm4846 G A 1: 166,491,545 T208I probably benign Het
Gorab A G 1: 163,386,605 L252P probably damaging Het
Gtsf2 A G 15: 103,444,561 C63R probably damaging Het
Hal T C 10: 93,489,174 V15A probably damaging Het
Hmcn1 A T 1: 150,876,419 probably benign Het
Hormad2 A T 11: 4,408,833 H191Q possibly damaging Het
Hspa2 A T 12: 76,405,216 D228V probably damaging Het
Igfn1 A T 1: 135,968,529 M1433K probably benign Het
Il18 A G 9: 50,575,328 D19G probably damaging Het
Il1rl2 G A 1: 40,329,056 V129I probably benign Het
Inpp5b C A 4: 124,782,408 Y352* probably null Het
Insrr A T 3: 87,813,156 M1034L possibly damaging Het
Jmjd1c T C 10: 67,225,755 S1296P probably damaging Het
Kdm5b G T 1: 134,621,023 probably null Het
Krba1 C T 6: 48,416,254 T998I probably benign Het
L3mbtl4 A G 17: 68,777,912 N606S probably benign Het
Lonrf1 T A 8: 36,231,159 N395I possibly damaging Het
Lpp A G 16: 24,971,970 D393G probably damaging Het
Lrrc17 A G 5: 21,560,530 I3M probably benign Het
Lrrtm4 A T 6: 80,022,046 Q147L probably damaging Het
Map1a A G 2: 121,302,941 M1413V probably benign Het
Mapk8ip2 A G 15: 89,456,658 E102G possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mdn1 T C 4: 32,698,916 probably benign Het
Mfng A C 15: 78,757,314 H294Q probably benign Het
Mical2 T A 7: 112,271,317 N4K probably benign Het
Mov10l1 T A 15: 88,998,839 V384E probably damaging Het
Myo18b A G 5: 112,873,576 probably benign Het
Nlrp1b T G 11: 71,182,415 I201L probably damaging Het
Nos2 C T 11: 78,940,077 P249L probably damaging Het
Notch4 A G 17: 34,575,091 T681A probably damaging Het
Nr1i3 C T 1: 171,217,236 probably benign Het
Obscn A G 11: 59,008,507 probably null Het
Olfr1024 T A 2: 85,904,686 M123L possibly damaging Het
Olfr1230 C T 2: 89,296,739 C177Y probably damaging Het
Olfr1248 A T 2: 89,618,094 Y33N probably damaging Het
Olfr237-ps1 A T 6: 43,153,461 H52L probably benign Het
Olfr328 C A 11: 58,551,636 C201F probably damaging Het
Olfr452 C T 6: 42,790,596 R186* probably null Het
Olfr517 C T 7: 108,868,850 M101I possibly damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr705 T A 7: 106,714,701 probably benign Het
Olfr881 A G 9: 37,993,142 T217A probably benign Het
Onecut2 A T 18: 64,340,749 I124F possibly damaging Het
Otol1 G A 3: 70,027,604 G310R probably damaging Het
Oxct2b T A 4: 123,116,840 S184R possibly damaging Het
Oxct2b ACTG A 4: 123,116,912 probably benign Het
P2rx6 A G 16: 17,567,427 probably benign Het
Pde4a A G 9: 21,204,403 N411S probably damaging Het
Phkb A T 8: 86,056,524 D983V probably benign Het
Piezo2 G A 18: 63,024,451 T2396I probably damaging Het
Pik3ap1 T A 19: 41,287,490 D717V probably damaging Het
Plce1 T A 19: 38,778,021 probably benign Het
Plekhg1 A G 10: 3,937,853 I261V probably damaging Het
Ppfia4 T C 1: 134,324,113 H441R probably damaging Het
Prpf8 T A 11: 75,501,942 probably benign Het
Ptn T A 6: 36,741,453 probably benign Het
Ptpn13 A G 5: 103,501,496 Y255C possibly damaging Het
Ptpn4 A G 1: 119,765,915 Y126H probably damaging Het
Ptprc T C 1: 138,088,697 N505D probably damaging Het
Ptprs T A 17: 56,454,220 I116F possibly damaging Het
Rab1a T G 11: 20,223,169 V90G probably damaging Het
Rcor1 T C 12: 111,101,668 V267A probably benign Het
Reep4 A G 14: 70,547,238 probably null Het
Rere T A 4: 150,615,322 probably benign Het
Rin3 T A 12: 102,387,564 Y743* probably null Het
Rprm A G 2: 54,085,055 S84P probably damaging Het
Sdhaf2 C T 19: 10,517,019 E109K probably damaging Het
Sec31b G T 19: 44,534,786 Q24K probably damaging Het
Sema5a T C 15: 32,574,803 probably benign Het
Sh3pxd2a T C 19: 47,267,747 Y844C probably damaging Het
Shmt2 A C 10: 127,520,072 N134K probably damaging Het
Slc9a8 C T 2: 167,424,205 A34V probably benign Het
Spidr A C 16: 16,140,072 S64A possibly damaging Het
Stk10 A G 11: 32,617,882 T895A probably benign Het
Syne2 A T 12: 76,033,591 probably benign Het
Szt2 T C 4: 118,372,952 probably null Het
Tecpr1 A T 5: 144,214,081 V303D probably damaging Het
Tet3 A G 6: 83,373,794 Y1048H probably damaging Het
Tfb2m A G 1: 179,545,831 C101R probably damaging Het
Tg T C 15: 66,682,404 V556A probably damaging Het
Thbs4 A C 13: 92,767,184 I441M probably benign Het
Thsd7a A T 6: 12,379,594 Y944N probably damaging Het
Tm9sf3 C A 19: 41,247,892 probably benign Het
Tmem145 T C 7: 25,311,362 F359S probably damaging Het
Ttc21b C T 2: 66,222,798 probably benign Het
Ttn A G 2: 76,749,536 V23671A probably damaging Het
Txnl4b T C 8: 109,571,471 I78T probably benign Het
Ubr4 C A 4: 139,406,578 L762I probably damaging Het
Ubr4 T C 4: 139,480,838 probably null Het
Ugt1a8 C T 1: 88,088,357 P164L probably damaging Het
Unc13b T C 4: 43,263,559 S1594P probably damaging Het
Utrn A T 10: 12,402,895 F912I probably benign Het
Vat1l T C 8: 114,236,579 probably benign Het
Vmn1r50 T A 6: 90,107,881 S203T probably damaging Het
Vmn2r4 A T 3: 64,389,363 L667Q probably damaging Het
Vmn2r66 T G 7: 85,006,815 Q331P probably damaging Het
Wdsub1 A T 2: 59,878,325 V68D possibly damaging Het
Wnk2 C G 13: 49,085,394 A564P possibly damaging Het
Wnk2 T A 13: 49,085,396 K563M probably damaging Het
Zan T A 5: 137,470,318 H297L probably damaging Het
Zfp426 A T 9: 20,470,031 H539Q probably damaging Het
Zfp488 T A 14: 33,970,540 N222I probably damaging Het
Zfp536 T A 7: 37,568,818 H391L probably damaging Het
Zp1 T A 19: 10,916,207 N31I probably damaging Het
Other mutations in Cyp2c29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cyp2c29 APN 19 39321699 splice site probably benign
IGL00482:Cyp2c29 APN 19 39325023 missense probably damaging 0.97
IGL00694:Cyp2c29 APN 19 39321635 missense possibly damaging 0.64
IGL00836:Cyp2c29 APN 19 39324990 missense probably damaging 0.98
IGL00858:Cyp2c29 APN 19 39307656 missense probably damaging 1.00
IGL01350:Cyp2c29 APN 19 39330327 missense probably damaging 1.00
IGL01455:Cyp2c29 APN 19 39329117 missense possibly damaging 0.89
IGL01718:Cyp2c29 APN 19 39330260 missense possibly damaging 0.48
IGL01977:Cyp2c29 APN 19 39290897 splice site probably benign
IGL01991:Cyp2c29 APN 19 39330315 missense probably damaging 1.00
IGL02097:Cyp2c29 APN 19 39307620 missense probably damaging 1.00
IGL02267:Cyp2c29 APN 19 39330422 missense probably benign 0.19
IGL02451:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02452:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02548:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02549:Cyp2c29 APN 19 39309785 missense possibly damaging 0.48
IGL02938:Cyp2c29 APN 19 39287123 missense probably damaging 0.99
IGL03252:Cyp2c29 APN 19 39287175 missense probably damaging 1.00
IGL03367:Cyp2c29 APN 19 39329215 missense probably damaging 0.97
H8562:Cyp2c29 UTSW 19 39309662 missense probably damaging 1.00
IGL03052:Cyp2c29 UTSW 19 39287218 missense possibly damaging 0.90
R0415:Cyp2c29 UTSW 19 39329095 splice site probably benign
R0690:Cyp2c29 UTSW 19 39309726 missense probably benign 0.00
R1531:Cyp2c29 UTSW 19 39324968 missense probably damaging 1.00
R1730:Cyp2c29 UTSW 19 39324945 missense possibly damaging 0.79
R1981:Cyp2c29 UTSW 19 39307772 splice site probably null
R2113:Cyp2c29 UTSW 19 39330264 missense probably damaging 1.00
R2220:Cyp2c29 UTSW 19 39287232 missense probably benign 0.09
R3873:Cyp2c29 UTSW 19 39329144 missense probably damaging 0.99
R4424:Cyp2c29 UTSW 19 39287176 missense probably damaging 0.98
R4451:Cyp2c29 UTSW 19 39290826 missense probably damaging 0.99
R4803:Cyp2c29 UTSW 19 39324995 missense probably benign 0.01
R5288:Cyp2c29 UTSW 19 39330372 missense probably damaging 0.96
R5474:Cyp2c29 UTSW 19 39324992 missense probably damaging 1.00
R5475:Cyp2c29 UTSW 19 39330287 missense possibly damaging 0.91
R5893:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R5894:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R6000:Cyp2c29 UTSW 19 39307606 critical splice acceptor site probably null
R6144:Cyp2c29 UTSW 19 39321609 missense possibly damaging 0.96
R6296:Cyp2c29 UTSW 19 39330261 missense possibly damaging 0.64
R6365:Cyp2c29 UTSW 19 39307754 missense probably damaging 1.00
R6449:Cyp2c29 UTSW 19 39290867 missense probably benign 0.05
R6464:Cyp2c29 UTSW 19 39329225 missense probably damaging 0.96
R6919:Cyp2c29 UTSW 19 39291141 missense probably benign 0.26
R6978:Cyp2c29 UTSW 19 39321663 missense probably damaging 1.00
R7038:Cyp2c29 UTSW 19 39287127 missense probably benign 0.01
R7040:Cyp2c29 UTSW 19 39330337 missense possibly damaging 0.95
R7391:Cyp2c29 UTSW 19 39307767 missense probably null 0.98
R8712:Cyp2c29 UTSW 19 39321694 critical splice donor site probably benign
X0024:Cyp2c29 UTSW 19 39321599 missense probably benign 0.01
Z1176:Cyp2c29 UTSW 19 39324997 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- aGTCAgggaatggagagattcaccag -3'

Sequencing Primer
(F):5'- cacacacacacagacaaataaac -3'
Posted On2013-06-12