Mutagenetix > Incidental Mutation

Incidental Mutation 'R0505:Plxna2'

47429

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

038700-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 194644348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 197 (T197A)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027952
AA Change: T197A

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: T197A

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125381

Meta Mutation Damage Score

0.1190

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (119/121)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,291,058	Y974H	probably benign	Het
Abca2	G	T	2: 25,434,894	G300V	probably benign	Het
Abi1	A	G	2: 22,962,504		probably benign	Het
Actr10	T	A	12: 70,959,964	Y332N	probably damaging	Het
Adam25	G	T	8: 40,755,224	C509F	probably damaging	Het
Adck1	A	T	12: 88,371,691		probably benign	Het
Adgra3	A	G	5: 50,009,334		probably null	Het
Adgrl1	G	T	8: 83,934,650		probably benign	Het
Akr1c21	A	G	13: 4,576,307	Y110C	probably damaging	Het
Arhgef25	T	C	10: 127,183,697	I463V	probably null	Het
Atp6v1e2	C	T	17: 86,944,578	V131M	probably benign	Het
Bdnf	A	G	2: 109,675,343		probably null	Het
C7	A	T	15: 4,994,142		probably benign	Het
Cdc27	T	C	11: 104,528,288	T273A	probably benign	Het
Cdo1	T	A	18: 46,715,611	I187F	probably benign	Het
Cep104	A	T	4: 153,996,304	T742S	probably benign	Het
Ckm	A	T	7: 19,419,452	K223*	probably null	Het
Cmtr1	C	T	17: 29,676,285	P586L	probably benign	Het
Csmd1	C	T	8: 15,992,758	R2325Q	probably damaging	Het
Dcpp1	A	T	17: 23,882,594	I106L	possibly damaging	Het
Diaph3	A	C	14: 87,090,964		probably benign	Het
Dnah11	A	G	12: 118,106,510	V1520A	probably damaging	Het
Dnajc25	T	A	4: 59,020,438	M168K		Het
Dpp3	T	C	19: 4,914,654	N542D	probably damaging	Het
Ebf2	A	T	14: 67,371,736	K199*	probably null	Het
Efcab11	T	A	12: 99,719,035	Q160L	probably benign	Het
Eif2ak4	T	A	2: 118,431,036	S686T	probably benign	Het
Epha6	C	T	16: 60,205,732	S449N	possibly damaging	Het
Ercc4	T	C	16: 13,126,467	V329A	probably benign	Het
Faf1	T	C	4: 109,840,403	F309L	possibly damaging	Het
Fam102b	T	C	3: 108,980,204	E248G	probably benign	Het
G6pd2	C	A	5: 61,809,567	D228E	probably benign	Het
Ggt1	T	G	10: 75,585,957	V546G	probably damaging	Het
Gm14139	T	A	2: 150,193,080	C471*	probably null	Het
Gpatch4	G	T	3: 88,051,217	V3F	probably damaging	Het
Gprin3	A	G	6: 59,353,387	L645P	probably damaging	Het
Hyal2	A	G	9: 107,572,071	Y342C	probably benign	Het
Igf2bp2	A	G	16: 22,089,099	I16T	possibly damaging	Het
Inca1	T	C	11: 70,690,199	Y61C	probably damaging	Het
Ipo5	T	C	14: 120,942,733	W860R	possibly damaging	Het
Kcnj9	C	T	1: 172,323,024	A341T	probably benign	Het
Kdm5b	T	C	1: 134,602,571	V440A	probably damaging	Het
L3mbtl1	C	T	2: 162,947,335		probably benign	Het
Lin54	G	A	5: 100,452,293	T307I	probably damaging	Het
Lrrc18	C	A	14: 33,009,139	Q212K	probably benign	Het
Lrrc37a	A	G	11: 103,503,025	S525P	probably benign	Het
Lrrc71	T	A	3: 87,745,699	S137C	probably damaging	Het
Lrrk1	A	T	7: 66,290,908		probably null	Het
Man2b2	G	A	5: 36,816,198	S58L	probably benign	Het
Masp1	T	A	16: 23,458,138	H539L	probably benign	Het
Med1	G	A	11: 98,156,904	P1022L	probably damaging	Het
Meis1	T	A	11: 19,011,360	H171L	probably damaging	Het
Mier1	T	A	4: 103,155,623		probably benign	Het
Mkl2	C	T	16: 13,412,526	T1025I	possibly damaging	Het
Mmp13	A	T	9: 7,272,929	R96S	probably damaging	Het
Mms19	G	A	19: 41,953,734	T38I	probably damaging	Het
Mrc1	G	A	2: 14,310,032	C976Y	probably damaging	Het
Naalad2	A	G	9: 18,385,895	Y32H	probably benign	Het
Ndufs1	A	G	1: 63,143,926		probably benign	Het
Nefm	C	T	14: 68,124,159	D219N	probably damaging	Het
Nwd1	C	T	8: 72,662,337	P172L	probably damaging	Het
Nwd2	T	A	5: 63,805,111	D679E	probably damaging	Het
Ogdh	T	A	11: 6,339,936		probably benign	Het
Olfm3	T	A	3: 115,122,681	S421T	possibly damaging	Het
Olfr1281	A	T	2: 111,329,328	N303I	probably benign	Het
Olfr1445	T	C	19: 12,884,079	L66P	probably damaging	Het
Olfr1445	A	G	19: 12,884,546	T222A	probably damaging	Het
Olfr559	T	A	7: 102,724,029	I154F	probably damaging	Het
Olfr628	T	C	7: 103,732,376	V150A	probably benign	Het
Olfr988	A	G	2: 85,353,749	M59T	possibly damaging	Het
Opn5	T	G	17: 42,592,953	T164P	possibly damaging	Het
Pde7b	C	T	10: 20,438,746	V166M	probably damaging	Het
Pik3ap1	T	C	19: 41,324,564	N370S	probably damaging	Het
Pkhd1l1	A	T	15: 44,589,418	D3913V	probably damaging	Het
Pld1	A	G	3: 28,120,822	I90V	possibly damaging	Het
Plxna4	A	T	6: 32,202,119	M987K	probably benign	Het
Pmch	A	G	10: 88,091,359	N75D	probably benign	Het
Prom2	T	A	2: 127,532,867	Q583L	possibly damaging	Het
Pyroxd1	T	A	6: 142,353,562	M148K	possibly damaging	Het
R3hdm2	C	T	10: 127,457,700	L158F	probably damaging	Het
Rapgef6	A	T	11: 54,625,963	T349S	probably benign	Het
Rfx5	C	T	3: 94,956,355	T105I	probably damaging	Het
Rif1	C	A	2: 52,110,737	P1401Q	probably damaging	Het
Robo3	G	A	9: 37,416,759		probably benign	Het
Rpn1	T	A	6: 88,090,242	S195T	probably benign	Het
Rslcan18	C	A	13: 67,102,119	K17N	probably benign	Het
Rsph3b	A	T	17: 6,941,727	I48N	probably damaging	Het
Sbf2	A	T	7: 110,399,343	Y628N	probably damaging	Het
Sis	T	C	3: 72,960,296	T139A	probably benign	Het
Slc22a14	A	G	9: 119,172,034		probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Smarcb1	T	C	10: 75,897,066	T372A	probably damaging	Het
Spidr	T	A	16: 16,037,667	H328L	probably damaging	Het
Sun5	T	A	2: 153,870,952	D16V	probably damaging	Het
Syde2	G	A	3: 146,014,380	E1053K	possibly damaging	Het
Syne2	T	C	12: 76,099,464	S6419P	probably damaging	Het
Tenm3	G	A	8: 48,341,160		probably benign	Het
Timm44	C	A	8: 4,260,532	E407*	probably null	Het
Tmem189	A	T	2: 167,644,987		probably benign	Het
Tnpo2	A	G	8: 85,047,362	T342A	probably benign	Het
Trio	A	G	15: 27,767,907	C1964R	probably benign	Het
Trip11	A	C	12: 101,885,672	L711R	probably damaging	Het
Trp53bp1	A	T	2: 121,269,969	H101Q	probably damaging	Het
Trpm6	A	G	19: 18,873,902		probably benign	Het
Ttn	A	T	2: 76,849,991		probably benign	Het
Ucp1	T	A	8: 83,295,307	M256K	possibly damaging	Het
Uhrf1bp1l	T	C	10: 89,791,443	S145P	probably damaging	Het
Unc5a	T	A	13: 55,004,954	S838T	probably damaging	Het
Uxs1	T	C	1: 43,764,886		probably null	Het
Vmn2r108	A	T	17: 20,462,834	C703S	possibly damaging	Het
Zc3hav1	C	T	6: 38,332,664	G408R	probably damaging	Het
Zfp609	G	A	9: 65,703,462	L740F	possibly damaging	Het
Zfp69	T	C	4: 120,931,095	E341G	probably damaging	Het
Zfp707	A	T	15: 75,975,256	H312L	probably damaging	Het
Zfp773	T	C	7: 7,133,024	D191G	probably benign	Het
Zgrf1	C	A	3: 127,573,238	D755E	probably benign	Het
Zscan5b	T	A	7: 6,239,075	I431N	probably damaging	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGCAAGCTCCTGCGACTAGATGAC -3'
(R):5'- TGCCCCTTGGAGAAGATGGCAAAC -3'

Sequencing Primer
(F):5'- GCGACTAGATGACCTCTTCATCC -3'
(R):5'- AACAGGACATCTTCGTCGCTG -3'

Posted On

2013-06-12