Incidental Mutation 'R3900:Khdc3'
ID474452
Institutional Source Beutler Lab
Gene Symbol Khdc3
Ensembl Gene ENSMUSG00000092622
Gene NameKH domain containing 3, subcortical maternal complex member
Synonyms2410004A20Rik, FILIA, ecat1
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3900 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location73101836-73104438 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 73104346 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034737] [ENSMUST00000167514] [ENSMUST00000172578] [ENSMUST00000173734] [ENSMUST00000174203]
Predicted Effect probably benign
Transcript: ENSMUST00000034737
SMART Domains Protein: ENSMUSP00000034737
Gene: ENSMUSG00000092622

DomainStartEndE-ValueType
Pfam:MOEP19 28 113 4.5e-34 PFAM
internal_repeat_1 117 217 6.81e-11 PROSPERO
internal_repeat_1 218 316 6.81e-11 PROSPERO
internal_repeat_2 275 397 3.62e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000167514
SMART Domains Protein: ENSMUSP00000132527
Gene: ENSMUSG00000092622

DomainStartEndE-ValueType
internal_repeat_1 117 212 2.21e-8 PROSPERO
internal_repeat_1 207 356 2.21e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172578
SMART Domains Protein: ENSMUSP00000133850
Gene: ENSMUSG00000092622

DomainStartEndE-ValueType
PDB:3V69|B 1 75 4e-49 PDB
Predicted Effect unknown
Transcript: ENSMUST00000173734
AA Change: S342P
SMART Domains Protein: ENSMUSP00000133915
Gene: ENSMUSG00000092622
AA Change: S342P

DomainStartEndE-ValueType
internal_repeat_2 116 194 1.27e-8 PROSPERO
internal_repeat_1 117 231 1.6e-13 PROSPERO
internal_repeat_1 231 341 1.6e-13 PROSPERO
internal_repeat_2 267 344 1.27e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000174203
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the KHDC1 family, members of which contain an atypical KH domain that may not bind RNA like canonical KH domains. This gene is specifically expressed in the oocytes, and recent studies suggest that it may function as a regulator of genomic imprinting in the oocyte. Mutations in this gene are associated with recurrent biparental complete hydatidiform mole. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display a maternal effect defect in embryogenesis with delayed embryonic development and spindle abnormalities resulting in decreased litter sizes for homozygous females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Khdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02987:Khdc3 APN 9 73102666 missense possibly damaging 0.56
R1487:Khdc3 UTSW 9 73102564 missense probably benign 0.19
R1523:Khdc3 UTSW 9 73103491 missense possibly damaging 0.53
R1545:Khdc3 UTSW 9 73103660 missense probably benign 0.05
R1951:Khdc3 UTSW 9 73103237 missense possibly damaging 0.48
R2935:Khdc3 UTSW 9 73103705 missense possibly damaging 0.92
R3076:Khdc3 UTSW 9 73102930 missense probably damaging 1.00
R3880:Khdc3 UTSW 9 73103590 missense possibly damaging 0.73
R3899:Khdc3 UTSW 9 73104346 intron probably benign
R4224:Khdc3 UTSW 9 73102871 missense possibly damaging 0.92
R4412:Khdc3 UTSW 9 73102874 missense possibly damaging 0.93
R4529:Khdc3 UTSW 9 73104019 missense possibly damaging 0.83
R4647:Khdc3 UTSW 9 73102586 missense possibly damaging 0.81
R4648:Khdc3 UTSW 9 73102586 missense possibly damaging 0.81
R5153:Khdc3 UTSW 9 73103438 missense probably benign 0.18
R5261:Khdc3 UTSW 9 73103486 missense possibly damaging 0.92
X0024:Khdc3 UTSW 9 73103924 missense probably benign 0.01
X0026:Khdc3 UTSW 9 73102983 missense possibly damaging 0.95
X0066:Khdc3 UTSW 9 73104181 missense probably benign 0.00
Predicted Primers
Posted On2017-04-14