Incidental Mutation 'R3916:P4ha2'
ID474559
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
SynonymsP4hl
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R3916 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54100095-54131665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54126248 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 441 (D441G)
Ref Sequence ENSEMBL: ENSMUSP00000133275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000174616]
Predicted Effect probably benign
Transcript: ENSMUST00000019050
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093107
AA Change: D441G

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906
AA Change: D441G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142583
Predicted Effect probably benign
Transcript: ENSMUST00000174616
AA Change: D441G

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906
AA Change: D441G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T G 2: 68,731,985 F319V possibly damaging Het
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Anks3 A G 16: 4,947,279 Y423H probably damaging Het
Arfgef1 A T 1: 10,189,443 V600D probably benign Het
Arhgef18 T C 8: 3,454,197 F939L probably benign Het
Arhgef2 A G 3: 88,633,033 N127S probably damaging Het
Arid1b A G 17: 5,342,653 S2100G probably benign Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Atrnl1 T C 19: 57,935,652 V1283A possibly damaging Het
Bpifb5 A C 2: 154,228,181 K184Q probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cant1 A G 11: 118,408,746 V259A probably damaging Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Cyp4f18 A T 8: 71,996,037 F256Y probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dync1i2 A G 2: 71,249,372 T377A probably damaging Het
F2 G A 2: 91,625,488 T600M probably damaging Het
Fam91a1 C T 15: 58,430,734 H308Y probably damaging Het
Fkbp2 C A 19: 6,978,557 probably null Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Heatr3 T G 8: 88,150,371 probably null Het
Ifi204 T G 1: 173,755,775 K292N possibly damaging Het
Itpkc A T 7: 27,228,303 I62N probably benign Het
Kcnab1 G A 3: 65,304,164 probably null Het
Krt88 G A 15: 101,452,928 probably null Het
Larp4 C T 15: 99,990,403 T107I probably benign Het
Lmo7 T C 14: 101,929,342 probably benign Het
Lrrc37a T C 11: 103,455,518 Y3174C possibly damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myh7 C A 14: 54,974,046 E1555D probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Obox3 C A 7: 15,627,226 C38F probably benign Het
Pcdhb14 A T 18: 37,448,545 I235F possibly damaging Het
Rasgrf2 A G 13: 92,030,788 V259A probably damaging Het
Scn1a T C 2: 66,277,613 T1590A probably damaging Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Sema3b A G 9: 107,600,458 F482S probably damaging Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a3 A G 13: 73,562,308 I346V probably benign Het
Slu7 G T 11: 43,440,684 probably null Het
Spns1 A T 7: 126,371,539 probably null Het
Supv3l1 T C 10: 62,449,420 D89G possibly damaging Het
Taf1c G A 8: 119,600,505 R412W probably damaging Het
Tctn3 T A 19: 40,607,649 T305S possibly damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tet2 T C 3: 133,486,055 K873E possibly damaging Het
Thada G A 17: 84,441,782 A587V possibly damaging Het
Tmprss15 T A 16: 78,985,996 N712Y probably damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Tnrc6a A C 7: 123,181,384 Q1332H probably damaging Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Uba5 A T 9: 104,054,190 C227S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Unc80 T C 1: 66,677,495 C2925R probably benign Het
Vmn2r83 G A 10: 79,478,910 G331R probably benign Het
Xirp2 G T 2: 67,511,422 V1336F probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54119305 missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54120158 missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54114170 missense probably benign 0.07
IGL02053:P4ha2 APN 11 54117587 missense probably benign
FR4342:P4ha2 UTSW 11 54110251 small deletion probably benign
R0471:P4ha2 UTSW 11 54117608 missense possibly damaging 0.82
R0938:P4ha2 UTSW 11 54119322 missense possibly damaging 0.67
R1467:P4ha2 UTSW 11 54106410 intron probably benign
R1517:P4ha2 UTSW 11 54117645 missense probably benign
R1556:P4ha2 UTSW 11 54125010 missense probably damaging 0.98
R3498:P4ha2 UTSW 11 54119253 missense probably benign 0.28
R4853:P4ha2 UTSW 11 54120170 missense probably benign 0.01
R4932:P4ha2 UTSW 11 54125020 missense probably benign 0.05
R5020:P4ha2 UTSW 11 54131190 missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54120188 missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54126412 critical splice donor site probably null
R6632:P4ha2 UTSW 11 54117648 missense probably benign 0.07
R7023:P4ha2 UTSW 11 54131246 missense probably benign 0.01
R7068:P4ha2 UTSW 11 54110994 missense probably benign 0.03
RF001:P4ha2 UTSW 11 54110235 small deletion probably benign
RF018:P4ha2 UTSW 11 54110246 frame shift probably null
RF035:P4ha2 UTSW 11 54110235 small deletion probably benign
RF043:P4ha2 UTSW 11 54110250 frame shift probably null
Predicted Primers
Posted On2017-04-14