Incidental Mutation 'R0505:Zfp69'
ID 47456
Institutional Source Beutler Lab
Gene Symbol Zfp69
Ensembl Gene ENSMUSG00000064141
Gene Name zinc finger protein 69
Synonyms Zfp63, KRAB2, LOC381549
MMRRC Submission 038700-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0505 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 120787334-120808896 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120788292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 341 (E341G)
Ref Sequence ENSEMBL: ENSMUSP00000101888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106280] [ENSMUST00000106281] [ENSMUST00000130702]
AlphaFold A2A761
Predicted Effect probably damaging
Transcript: ENSMUST00000106280
AA Change: E341G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101887
Gene: ENSMUSG00000064141
AA Change: E341G

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106281
AA Change: E341G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101888
Gene: ENSMUSG00000064141
AA Change: E341G

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130702
SMART Domains Protein: ENSMUSP00000133312
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
KRAB 1 32 2.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132839
Meta Mutation Damage Score 0.2755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (119/121)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,241,058 (GRCm39) Y974H probably benign Het
Abca2 G T 2: 25,324,906 (GRCm39) G300V probably benign Het
Abi1 A G 2: 22,852,516 (GRCm39) probably benign Het
Actr10 T A 12: 71,006,738 (GRCm39) Y332N probably damaging Het
Adam25 G T 8: 41,208,261 (GRCm39) C509F probably damaging Het
Adck1 A T 12: 88,338,461 (GRCm39) probably benign Het
Adgra3 A G 5: 50,166,676 (GRCm39) probably null Het
Adgrl1 G T 8: 84,661,279 (GRCm39) probably benign Het
Akr1c21 A G 13: 4,626,306 (GRCm39) Y110C probably damaging Het
Arhgef25 T C 10: 127,019,566 (GRCm39) I463V probably null Het
Atp6v1e2 C T 17: 87,252,006 (GRCm39) V131M probably benign Het
Bdnf A G 2: 109,505,688 (GRCm39) probably null Het
Bltp3b T C 10: 89,627,305 (GRCm39) S145P probably damaging Het
C7 A T 15: 5,023,624 (GRCm39) probably benign Het
Cdc27 T C 11: 104,419,114 (GRCm39) T273A probably benign Het
Cdo1 T A 18: 46,848,678 (GRCm39) I187F probably benign Het
Cep104 A T 4: 154,080,761 (GRCm39) T742S probably benign Het
Ckm A T 7: 19,153,377 (GRCm39) K223* probably null Het
Cmtr1 C T 17: 29,895,259 (GRCm39) P586L probably benign Het
Csmd1 C T 8: 16,042,758 (GRCm39) R2325Q probably damaging Het
Dcpp1 A T 17: 24,101,568 (GRCm39) I106L possibly damaging Het
Diaph3 A C 14: 87,328,400 (GRCm39) probably benign Het
Dnah11 A G 12: 118,070,245 (GRCm39) V1520A probably damaging Het
Dnajc25 T A 4: 59,020,438 (GRCm39) M168K Het
Dpp3 T C 19: 4,964,682 (GRCm39) N542D probably damaging Het
Ebf2 A T 14: 67,609,185 (GRCm39) K199* probably null Het
Eeig2 T C 3: 108,887,520 (GRCm39) E248G probably benign Het
Efcab11 T A 12: 99,685,294 (GRCm39) Q160L probably benign Het
Eif2ak4 T A 2: 118,261,517 (GRCm39) S686T probably benign Het
Epha6 C T 16: 60,026,095 (GRCm39) S449N possibly damaging Het
Ercc4 T C 16: 12,944,331 (GRCm39) V329A probably benign Het
Faf1 T C 4: 109,697,600 (GRCm39) F309L possibly damaging Het
G6pd2 C A 5: 61,966,910 (GRCm39) D228E probably benign Het
Ggt1 T G 10: 75,421,791 (GRCm39) V546G probably damaging Het
Gpatch4 G T 3: 87,958,524 (GRCm39) V3F probably damaging Het
Gprin3 A G 6: 59,330,372 (GRCm39) L645P probably damaging Het
Hyal2 A G 9: 107,449,270 (GRCm39) Y342C probably benign Het
Igf2bp2 A G 16: 21,907,849 (GRCm39) I16T possibly damaging Het
Inca1 T C 11: 70,581,025 (GRCm39) Y61C probably damaging Het
Ipo5 T C 14: 121,180,145 (GRCm39) W860R possibly damaging Het
Kcnj9 C T 1: 172,150,591 (GRCm39) A341T probably benign Het
Kdm5b T C 1: 134,530,309 (GRCm39) V440A probably damaging Het
L3mbtl1 C T 2: 162,789,255 (GRCm39) probably benign Het
Lin54 G A 5: 100,600,152 (GRCm39) T307I probably damaging Het
Lrrc18 C A 14: 32,731,096 (GRCm39) Q212K probably benign Het
Lrrc37a A G 11: 103,393,851 (GRCm39) S525P probably benign Het
Lrrc71 T A 3: 87,653,006 (GRCm39) S137C probably damaging Het
Lrrk1 A T 7: 65,940,656 (GRCm39) probably null Het
Man2b2 G A 5: 36,973,542 (GRCm39) S58L probably benign Het
Masp1 T A 16: 23,276,888 (GRCm39) H539L probably benign Het
Med1 G A 11: 98,047,730 (GRCm39) P1022L probably damaging Het
Meis1 T A 11: 18,961,360 (GRCm39) H171L probably damaging Het
Mier1 T A 4: 103,012,820 (GRCm39) probably benign Het
Mmp13 A T 9: 7,272,929 (GRCm39) R96S probably damaging Het
Mms19 G A 19: 41,942,173 (GRCm39) T38I probably damaging Het
Mrc1 G A 2: 14,314,843 (GRCm39) C976Y probably damaging Het
Mrtfb C T 16: 13,230,390 (GRCm39) T1025I possibly damaging Het
Naalad2 A G 9: 18,297,191 (GRCm39) Y32H probably benign Het
Ndufs1 A G 1: 63,183,085 (GRCm39) probably benign Het
Nefm C T 14: 68,361,608 (GRCm39) D219N probably damaging Het
Nwd1 C T 8: 73,388,965 (GRCm39) P172L probably damaging Het
Nwd2 T A 5: 63,962,454 (GRCm39) D679E probably damaging Het
Ogdh T A 11: 6,289,936 (GRCm39) probably benign Het
Olfm3 T A 3: 114,916,330 (GRCm39) S421T possibly damaging Het
Opn5 T G 17: 42,903,844 (GRCm39) T164P possibly damaging Het
Or4k37 A T 2: 111,159,673 (GRCm39) N303I probably benign Het
Or51a25 T A 7: 102,373,236 (GRCm39) I154F probably damaging Het
Or52a24 T C 7: 103,381,583 (GRCm39) V150A probably benign Het
Or5ak20 A G 2: 85,184,093 (GRCm39) M59T possibly damaging Het
Or5b12b T C 19: 12,861,443 (GRCm39) L66P probably damaging Het
Or5b12b A G 19: 12,861,910 (GRCm39) T222A probably damaging Het
Pde7b C T 10: 20,314,492 (GRCm39) V166M probably damaging Het
Peds1 A T 2: 167,486,907 (GRCm39) probably benign Het
Pik3ap1 T C 19: 41,313,003 (GRCm39) N370S probably damaging Het
Pkhd1l1 A T 15: 44,452,814 (GRCm39) D3913V probably damaging Het
Pld1 A G 3: 28,174,971 (GRCm39) I90V possibly damaging Het
Plxna2 A G 1: 194,326,656 (GRCm39) T197A possibly damaging Het
Plxna4 A T 6: 32,179,054 (GRCm39) M987K probably benign Het
Pmch A G 10: 87,927,221 (GRCm39) N75D probably benign Het
Prom2 T A 2: 127,374,787 (GRCm39) Q583L possibly damaging Het
Pyroxd1 T A 6: 142,299,288 (GRCm39) M148K possibly damaging Het
R3hdm2 C T 10: 127,293,569 (GRCm39) L158F probably damaging Het
Rapgef6 A T 11: 54,516,789 (GRCm39) T349S probably benign Het
Rfx5 C T 3: 94,863,666 (GRCm39) T105I probably damaging Het
Rif1 C A 2: 52,000,749 (GRCm39) P1401Q probably damaging Het
Robo3 G A 9: 37,328,055 (GRCm39) probably benign Het
Rpn1 T A 6: 88,067,224 (GRCm39) S195T probably benign Het
Rslcan18 C A 13: 67,250,183 (GRCm39) K17N probably benign Het
Rsph3b A T 17: 7,209,126 (GRCm39) I48N probably damaging Het
Sbf2 A T 7: 109,998,550 (GRCm39) Y628N probably damaging Het
Sis T C 3: 72,867,629 (GRCm39) T139A probably benign Het
Slc22a14 A G 9: 119,001,100 (GRCm39) probably benign Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Smarcb1 T C 10: 75,732,900 (GRCm39) T372A probably damaging Het
Spidr T A 16: 15,855,531 (GRCm39) H328L probably damaging Het
Sun5 T A 2: 153,712,872 (GRCm39) D16V probably damaging Het
Syde2 G A 3: 145,720,135 (GRCm39) E1053K possibly damaging Het
Syne2 T C 12: 76,146,238 (GRCm39) S6419P probably damaging Het
Tenm3 G A 8: 48,794,195 (GRCm39) probably benign Het
Timm44 C A 8: 4,310,532 (GRCm39) E407* probably null Het
Tnpo2 A G 8: 85,773,991 (GRCm39) T342A probably benign Het
Trio A G 15: 27,767,993 (GRCm39) C1964R probably benign Het
Trip11 A C 12: 101,851,931 (GRCm39) L711R probably damaging Het
Trp53bp1 A T 2: 121,100,450 (GRCm39) H101Q probably damaging Het
Trpm6 A G 19: 18,851,266 (GRCm39) probably benign Het
Ttn A T 2: 76,680,335 (GRCm39) probably benign Het
Ucp1 T A 8: 84,021,936 (GRCm39) M256K possibly damaging Het
Unc5a T A 13: 55,152,767 (GRCm39) S838T probably damaging Het
Uxs1 T C 1: 43,804,046 (GRCm39) probably null Het
Vmn2r108 A T 17: 20,683,096 (GRCm39) C703S possibly damaging Het
Zc3hav1 C T 6: 38,309,599 (GRCm39) G408R probably damaging Het
Zfp1004 T A 2: 150,035,000 (GRCm39) C471* probably null Het
Zfp609 G A 9: 65,610,744 (GRCm39) L740F possibly damaging Het
Zfp707 A T 15: 75,847,105 (GRCm39) H312L probably damaging Het
Zfp773 T C 7: 7,136,023 (GRCm39) D191G probably benign Het
Zgrf1 C A 3: 127,366,887 (GRCm39) D755E probably benign Het
Zscan5b T A 7: 6,242,074 (GRCm39) I431N probably damaging Het
Other mutations in Zfp69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Zfp69 APN 4 120,788,697 (GRCm39) missense probably damaging 1.00
IGL02604:Zfp69 APN 4 120,788,660 (GRCm39) missense probably benign 0.10
IGL03406:Zfp69 APN 4 120,788,281 (GRCm39) missense probably benign
R0613:Zfp69 UTSW 4 120,791,544 (GRCm39) missense probably benign
R0628:Zfp69 UTSW 4 120,806,622 (GRCm39) nonsense probably null
R0838:Zfp69 UTSW 4 120,788,478 (GRCm39) missense probably benign 0.09
R1669:Zfp69 UTSW 4 120,804,695 (GRCm39) utr 5 prime probably benign
R2060:Zfp69 UTSW 4 120,788,029 (GRCm39) missense probably damaging 0.98
R3740:Zfp69 UTSW 4 120,788,071 (GRCm39) splice site probably null
R4242:Zfp69 UTSW 4 120,791,672 (GRCm39) intron probably benign
R4770:Zfp69 UTSW 4 120,791,614 (GRCm39) missense probably damaging 0.99
R4998:Zfp69 UTSW 4 120,804,522 (GRCm39) missense possibly damaging 0.52
R5620:Zfp69 UTSW 4 120,787,719 (GRCm39) missense probably damaging 1.00
R6312:Zfp69 UTSW 4 120,806,714 (GRCm39) unclassified probably benign
R6534:Zfp69 UTSW 4 120,788,394 (GRCm39) missense probably benign 0.05
R7056:Zfp69 UTSW 4 120,788,295 (GRCm39) missense probably benign 0.01
R7061:Zfp69 UTSW 4 120,788,598 (GRCm39) missense possibly damaging 0.69
R7663:Zfp69 UTSW 4 120,792,323 (GRCm39) missense probably benign 0.17
R8169:Zfp69 UTSW 4 120,787,731 (GRCm39) missense probably damaging 1.00
R8348:Zfp69 UTSW 4 120,787,834 (GRCm39) missense probably damaging 1.00
R8389:Zfp69 UTSW 4 120,806,549 (GRCm39) missense possibly damaging 0.93
R9182:Zfp69 UTSW 4 120,792,308 (GRCm39) missense probably damaging 1.00
R9340:Zfp69 UTSW 4 120,788,013 (GRCm39) missense probably damaging 1.00
RF053:Zfp69 UTSW 4 120,804,544 (GRCm39) utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTTGCTAAGGTGTATCCTCTGCCTG -3'
(R):5'- AAGGCACGAGACGAGCCATTTG -3'

Sequencing Primer
(F):5'- tgtgtgagatatgctctatgactg -3'
(R):5'- AGACGAGCCATTTGGACCC -3'
Posted On 2013-06-12