Incidental Mutation 'R3917:Myd88'
ID474744
Institutional Source Beutler Lab
Gene Symbol Myd88
Ensembl Gene ENSMUSG00000032508
Gene Namemyeloid differentiation primary response gene 88
Synonyms
MMRRC Submission 040914-MU
Accession Numbers

VEGA: OTTMUST00000040319; MGI: 108005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3917 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119335934-119341411 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 119341398 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035092] [ENSMUST00000039784] [ENSMUST00000139870] [ENSMUST00000170400] [ENSMUST00000175743] [ENSMUST00000176351] [ENSMUST00000176397] [ENSMUST00000176546] [ENSMUST00000177463]
Predicted Effect probably benign
Transcript: ENSMUST00000035092
SMART Domains Protein: ENSMUSP00000035092
Gene: ENSMUSG00000032508

DomainStartEndE-ValueType
DEATH 19 109 7.17e-15 SMART
TIR 160 296 3.39e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039784
SMART Domains Protein: ENSMUSP00000042351
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 3.6e-88 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139870
SMART Domains Protein: ENSMUSP00000115746
Gene: ENSMUSG00000032508

DomainStartEndE-ValueType
Pfam:Death 50 109 3.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150837
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175743
SMART Domains Protein: ENSMUSP00000135439
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 291 4.2e-90 PFAM
Pfam:Thiolase_C 298 337 8.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176007
Predicted Effect probably benign
Transcript: ENSMUST00000176351
SMART Domains Protein: ENSMUSP00000134926
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 98 2.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176397
SMART Domains Protein: ENSMUSP00000135191
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 152 4.9e-38 PFAM
Pfam:Thiolase_N 148 246 4.8e-34 PFAM
Pfam:Thiolase_C 214 328 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176546
SMART Domains Protein: ENSMUSP00000134981
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 1 110 4.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176796
Predicted Effect probably benign
Transcript: ENSMUST00000177463
SMART Domains Protein: ENSMUSP00000135310
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 199 3.2e-50 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Targeted(9) Gene trapped(4) Chemically induced(5)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Myd88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Myd88 APN 9 119337352 unclassified probably benign
Bahia UTSW 9 119338109 intron probably null
Dani_alves UTSW 9 119337823 missense possibly damaging 0.69
lackadaisical UTSW 9 119338692 missense probably damaging 1.00
Myd88rev1 UTSW 9 119337394 missense possibly damaging 0.90
pococurante UTSW 9 119338114 missense probably damaging 1.00
R1695:Myd88 UTSW 9 119337842 intron probably null
R1878:Myd88 UTSW 9 119338620 missense probably benign 0.00
R2413:Myd88 UTSW 9 119337418 missense probably benign 0.06
R3417:Myd88 UTSW 9 119337490 missense possibly damaging 0.90
R3836:Myd88 UTSW 9 119338193 unclassified probably benign
R3892:Myd88 UTSW 9 119337816 missense possibly damaging 0.93
R4081:Myd88 UTSW 9 119339987 unclassified probably benign
R4634:Myd88 UTSW 9 119338109 intron probably null
R4637:Myd88 UTSW 9 119338109 intron probably null
R5091:Myd88 UTSW 9 119337823 missense possibly damaging 0.69
R5604:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
Predicted Primers
Posted On2017-04-14