Incidental Mutation 'R3917:Slc35a5'
ID474746
Institutional Source Beutler Lab
Gene Symbol Slc35a5
Ensembl Gene ENSMUSG00000022664
Gene Namesolute carrier family 35, member A5
Synonyms1010001J06Rik, D730043G07Rik, D16Ertd450e
MMRRC Submission 040914-MU
Accession Numbers

Genbank: NM_028756; MGI: 1921352

Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R3917 (G1)
Quality Score183
Status Not validated
Chromosome16
Chromosomal Location45139573-45158706 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to C at 45158158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023343] [ENSMUST00000023344] [ENSMUST00000114600] [ENSMUST00000180636] [ENSMUST00000181177] [ENSMUST00000181750]
Predicted Effect probably benign
Transcript: ENSMUST00000023343
SMART Domains Protein: ENSMUSP00000023343
Gene: ENSMUSG00000022663

DomainStartEndE-ValueType
Pfam:Autophagy_N 8 153 1.4e-55 PFAM
Pfam:Autophagy_act_C 204 265 8.8e-23 PFAM
Pfam:Autophagy_C 286 310 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023344
SMART Domains Protein: ENSMUSP00000023344
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 28 387 1.3e-54 PFAM
low complexity region 424 437 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114600
AA Change: F2L
SMART Domains Protein: ENSMUSP00000110247
Gene: ENSMUSG00000022664
AA Change: F2L

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Nuc_sug_transp 107 155 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180636
SMART Domains Protein: ENSMUSP00000137821
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:UAA 30 196 5.2e-8 PFAM
Pfam:TPT 31 177 3.3e-7 PFAM
Pfam:EamA 73 179 1.2e-7 PFAM
Pfam:Nuc_sug_transp 91 222 7.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181177
SMART Domains Protein: ENSMUSP00000137789
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 30 94 1.1e-12 PFAM
low complexity region 139 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181437
Predicted Effect probably benign
Transcript: ENSMUST00000181750
SMART Domains Protein: ENSMUSP00000137937
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
transmembrane domain 15 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which belongs to subfamily 35A of the solute carrier superfamily. The encoded protein is a nucleoside-sugar transporter. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI

 All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Slc35a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc35a5 APN 16 45152608 nonsense probably null
IGL01012:Slc35a5 APN 16 45143832 missense probably damaging 1.00
IGL01396:Slc35a5 APN 16 45151503 missense probably damaging 1.00
IGL03293:Slc35a5 APN 16 45143781 missense probably damaging 1.00
3-1:Slc35a5 UTSW 16 45143892 missense probably damaging 0.99
R1532:Slc35a5 UTSW 16 45151557 missense probably benign 0.03
R1561:Slc35a5 UTSW 16 45151521 missense possibly damaging 0.93
R1864:Slc35a5 UTSW 16 45143708 missense possibly damaging 0.66
R2086:Slc35a5 UTSW 16 45144265 missense probably damaging 0.99
R2887:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2888:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2889:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2890:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R3080:Slc35a5 UTSW 16 45144395 missense probably benign 0.06
R3434:Slc35a5 UTSW 16 45144033 missense probably benign 0.23
R3720:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3722:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3916:Slc35a5 UTSW 16 45158158 intron probably benign
R4616:Slc35a5 UTSW 16 45144292 missense probably benign 0.12
R6648:Slc35a5 UTSW 16 45143917 missense probably damaging 1.00
R6881:Slc35a5 UTSW 16 45144080 missense possibly damaging 0.83
R7730:Slc35a5 UTSW 16 45143883 missense probably damaging 0.97
R7832:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
R7915:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
Predicted Primers
Posted On2017-04-14