Mutagenetix > Incidental Mutation

Incidental Mutation 'R0505:Csmd1'

47476

Institutional Source

Beutler Lab

Gene Symbol

Csmd1

Ensembl Gene

ENSMUSG00000060924

Gene Name

CUB and Sushi multiple domains 1

Synonyms

MMRRC Submission

038700-MU

Accession Numbers

Genbank: NM_053171.2

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15892537-17535586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15992758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 2325 (R2325Q)

Ref Sequence

ENSEMBL: ENSMUSP00000080751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082104]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082104
AA Change: R2325Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: R2325Q

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CUB	32	140	1.46e-26	SMART
CCP	145	202	1.01e-11	SMART
CUB	208	312	1.05e-27	SMART
CCP	349	406	1.28e-8	SMART
CUB	411	522	2.34e-25	SMART
CCP	527	580	1.22e-14	SMART
CUB	584	692	1.61e-37	SMART
CCP	697	754	4.41e-12	SMART
CUB	758	866	6.55e-38	SMART
CCP	873	926	2.53e-12	SMART
CUB	930	1040	8.94e-22	SMART
CCP	1045	1100	7.06e-11	SMART
CUB	1104	1212	3.14e-26	SMART
CCP	1217	1273	1.18e-12	SMART
CUB	1277	1386	9.72e-32	SMART
CCP	1391	1447	2.06e-12	SMART
CUB	1451	1559	1.68e-35	SMART
CCP	1564	1621	2.53e-12	SMART
CUB	1625	1733	4.24e-14	SMART
CCP	1741	1798	9.46e-12	SMART
CUB	1802	1910	4.23e-32	SMART
CCP	1915	1970	8.23e-12	SMART
CUB	1974	2082	8.59e-33	SMART
CCP	2087	2142	6.09e-15	SMART
CUB	2146	2253	2.36e-30	SMART
CCP	2258	2315	1.1e-12	SMART
CUB	2320	2430	4.3e-24	SMART
CCP	2432	2490	2.94e-8	SMART
CCP	2495	2552	2.03e-11	SMART
CCP	2557	2617	1.22e-5	SMART
CCP	2622	2675	2.72e-12	SMART
CCP	2680	2733	5.86e-17	SMART
CCP	2738	2791	6.09e-15	SMART
CCP	2796	2854	9.1e-14	SMART
CCP	2859	2912	3.96e-14	SMART
CCP	2920	2973	4.41e-12	SMART
CCP	2978	3032	2.94e-8	SMART
CCP	3037	3092	6.59e-11	SMART
CCP	3097	3150	4.12e-12	SMART
CCP	3155	3208	7.92e-14	SMART
CCP	3216	3270	2.8e-14	SMART
CCP	3275	3330	3.78e-11	SMART
transmembrane domain	3487	3509	N/A	INTRINSIC

Meta Mutation Damage Score

0.2383

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (119/121)

MGI Phenotype

PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,291,058	Y974H	probably benign	Het
Abca2	G	T	2: 25,434,894	G300V	probably benign	Het
Abi1	A	G	2: 22,962,504		probably benign	Het
Actr10	T	A	12: 70,959,964	Y332N	probably damaging	Het
Adam25	G	T	8: 40,755,224	C509F	probably damaging	Het
Adck1	A	T	12: 88,371,691		probably benign	Het
Adgra3	A	G	5: 50,009,334		probably null	Het
Adgrl1	G	T	8: 83,934,650		probably benign	Het
Akr1c21	A	G	13: 4,576,307	Y110C	probably damaging	Het
Arhgef25	T	C	10: 127,183,697	I463V	probably null	Het
Atp6v1e2	C	T	17: 86,944,578	V131M	probably benign	Het
Bdnf	A	G	2: 109,675,343		probably null	Het
C7	A	T	15: 4,994,142		probably benign	Het
Cdc27	T	C	11: 104,528,288	T273A	probably benign	Het
Cdo1	T	A	18: 46,715,611	I187F	probably benign	Het
Cep104	A	T	4: 153,996,304	T742S	probably benign	Het
Ckm	A	T	7: 19,419,452	K223*	probably null	Het
Cmtr1	C	T	17: 29,676,285	P586L	probably benign	Het
Dcpp1	A	T	17: 23,882,594	I106L	possibly damaging	Het
Diaph3	A	C	14: 87,090,964		probably benign	Het
Dnah11	A	G	12: 118,106,510	V1520A	probably damaging	Het
Dnajc25	T	A	4: 59,020,438	M168K		Het
Dpp3	T	C	19: 4,914,654	N542D	probably damaging	Het
Ebf2	A	T	14: 67,371,736	K199*	probably null	Het
Efcab11	T	A	12: 99,719,035	Q160L	probably benign	Het
Eif2ak4	T	A	2: 118,431,036	S686T	probably benign	Het
Epha6	C	T	16: 60,205,732	S449N	possibly damaging	Het
Ercc4	T	C	16: 13,126,467	V329A	probably benign	Het
Faf1	T	C	4: 109,840,403	F309L	possibly damaging	Het
Fam102b	T	C	3: 108,980,204	E248G	probably benign	Het
G6pd2	C	A	5: 61,809,567	D228E	probably benign	Het
Ggt1	T	G	10: 75,585,957	V546G	probably damaging	Het
Gm14139	T	A	2: 150,193,080	C471*	probably null	Het
Gpatch4	G	T	3: 88,051,217	V3F	probably damaging	Het
Gprin3	A	G	6: 59,353,387	L645P	probably damaging	Het
Hyal2	A	G	9: 107,572,071	Y342C	probably benign	Het
Igf2bp2	A	G	16: 22,089,099	I16T	possibly damaging	Het
Inca1	T	C	11: 70,690,199	Y61C	probably damaging	Het
Ipo5	T	C	14: 120,942,733	W860R	possibly damaging	Het
Kcnj9	C	T	1: 172,323,024	A341T	probably benign	Het
Kdm5b	T	C	1: 134,602,571	V440A	probably damaging	Het
L3mbtl1	C	T	2: 162,947,335		probably benign	Het
Lin54	G	A	5: 100,452,293	T307I	probably damaging	Het
Lrrc18	C	A	14: 33,009,139	Q212K	probably benign	Het
Lrrc37a	A	G	11: 103,503,025	S525P	probably benign	Het
Lrrc71	T	A	3: 87,745,699	S137C	probably damaging	Het
Lrrk1	A	T	7: 66,290,908		probably null	Het
Man2b2	G	A	5: 36,816,198	S58L	probably benign	Het
Masp1	T	A	16: 23,458,138	H539L	probably benign	Het
Med1	G	A	11: 98,156,904	P1022L	probably damaging	Het
Meis1	T	A	11: 19,011,360	H171L	probably damaging	Het
Mier1	T	A	4: 103,155,623		probably benign	Het
Mkl2	C	T	16: 13,412,526	T1025I	possibly damaging	Het
Mmp13	A	T	9: 7,272,929	R96S	probably damaging	Het
Mms19	G	A	19: 41,953,734	T38I	probably damaging	Het
Mrc1	G	A	2: 14,310,032	C976Y	probably damaging	Het
Naalad2	A	G	9: 18,385,895	Y32H	probably benign	Het
Ndufs1	A	G	1: 63,143,926		probably benign	Het
Nefm	C	T	14: 68,124,159	D219N	probably damaging	Het
Nwd1	C	T	8: 72,662,337	P172L	probably damaging	Het
Nwd2	T	A	5: 63,805,111	D679E	probably damaging	Het
Ogdh	T	A	11: 6,339,936		probably benign	Het
Olfm3	T	A	3: 115,122,681	S421T	possibly damaging	Het
Olfr1281	A	T	2: 111,329,328	N303I	probably benign	Het
Olfr1445	T	C	19: 12,884,079	L66P	probably damaging	Het
Olfr1445	A	G	19: 12,884,546	T222A	probably damaging	Het
Olfr559	T	A	7: 102,724,029	I154F	probably damaging	Het
Olfr628	T	C	7: 103,732,376	V150A	probably benign	Het
Olfr988	A	G	2: 85,353,749	M59T	possibly damaging	Het
Opn5	T	G	17: 42,592,953	T164P	possibly damaging	Het
Pde7b	C	T	10: 20,438,746	V166M	probably damaging	Het
Pik3ap1	T	C	19: 41,324,564	N370S	probably damaging	Het
Pkhd1l1	A	T	15: 44,589,418	D3913V	probably damaging	Het
Pld1	A	G	3: 28,120,822	I90V	possibly damaging	Het
Plxna2	A	G	1: 194,644,348	T197A	possibly damaging	Het
Plxna4	A	T	6: 32,202,119	M987K	probably benign	Het
Pmch	A	G	10: 88,091,359	N75D	probably benign	Het
Prom2	T	A	2: 127,532,867	Q583L	possibly damaging	Het
Pyroxd1	T	A	6: 142,353,562	M148K	possibly damaging	Het
R3hdm2	C	T	10: 127,457,700	L158F	probably damaging	Het
Rapgef6	A	T	11: 54,625,963	T349S	probably benign	Het
Rfx5	C	T	3: 94,956,355	T105I	probably damaging	Het
Rif1	C	A	2: 52,110,737	P1401Q	probably damaging	Het
Robo3	G	A	9: 37,416,759		probably benign	Het
Rpn1	T	A	6: 88,090,242	S195T	probably benign	Het
Rslcan18	C	A	13: 67,102,119	K17N	probably benign	Het
Rsph3b	A	T	17: 6,941,727	I48N	probably damaging	Het
Sbf2	A	T	7: 110,399,343	Y628N	probably damaging	Het
Sis	T	C	3: 72,960,296	T139A	probably benign	Het
Slc22a14	A	G	9: 119,172,034		probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Smarcb1	T	C	10: 75,897,066	T372A	probably damaging	Het
Spidr	T	A	16: 16,037,667	H328L	probably damaging	Het
Sun5	T	A	2: 153,870,952	D16V	probably damaging	Het
Syde2	G	A	3: 146,014,380	E1053K	possibly damaging	Het
Syne2	T	C	12: 76,099,464	S6419P	probably damaging	Het
Tenm3	G	A	8: 48,341,160		probably benign	Het
Timm44	C	A	8: 4,260,532	E407*	probably null	Het
Tmem189	A	T	2: 167,644,987		probably benign	Het
Tnpo2	A	G	8: 85,047,362	T342A	probably benign	Het
Trio	A	G	15: 27,767,907	C1964R	probably benign	Het
Trip11	A	C	12: 101,885,672	L711R	probably damaging	Het
Trp53bp1	A	T	2: 121,269,969	H101Q	probably damaging	Het
Trpm6	A	G	19: 18,873,902		probably benign	Het
Ttn	A	T	2: 76,849,991		probably benign	Het
Ucp1	T	A	8: 83,295,307	M256K	possibly damaging	Het
Uhrf1bp1l	T	C	10: 89,791,443	S145P	probably damaging	Het
Unc5a	T	A	13: 55,004,954	S838T	probably damaging	Het
Uxs1	T	C	1: 43,764,886		probably null	Het
Vmn2r108	A	T	17: 20,462,834	C703S	possibly damaging	Het
Zc3hav1	C	T	6: 38,332,664	G408R	probably damaging	Het
Zfp609	G	A	9: 65,703,462	L740F	possibly damaging	Het
Zfp69	T	C	4: 120,931,095	E341G	probably damaging	Het
Zfp707	A	T	15: 75,975,256	H312L	probably damaging	Het
Zfp773	T	C	7: 7,133,024	D191G	probably benign	Het
Zgrf1	C	A	3: 127,573,238	D755E	probably benign	Het
Zscan5b	T	A	7: 6,239,075	I431N	probably damaging	Het

Other mutations in Csmd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Csmd1	APN	8	16009297	splice site	probably benign
IGL00433:Csmd1	APN	8	16231373	missense	probably damaging	1.00
IGL00500:Csmd1	APN	8	15921139	missense	probably damaging	1.00
IGL00666:Csmd1	APN	8	16189990	missense	probably damaging	1.00
IGL00913:Csmd1	APN	8	16071287	missense	probably benign	0.00
IGL01012:Csmd1	APN	8	15917341	missense	probably benign	0.00
IGL01123:Csmd1	APN	8	17534928	missense	possibly damaging	0.96
IGL01348:Csmd1	APN	8	15910596	missense	probably damaging	0.99
IGL01444:Csmd1	APN	8	16200055	missense	probably benign	0.00
IGL01530:Csmd1	APN	8	15903195	missense	probably damaging	0.99
IGL01548:Csmd1	APN	8	16288646	nonsense	probably null
IGL01814:Csmd1	APN	8	16501375	missense	probably damaging	1.00
IGL01889:Csmd1	APN	8	15998857	missense	probably damaging	1.00
IGL02055:Csmd1	APN	8	16069001	missense	probably damaging	0.99
IGL02066:Csmd1	APN	8	15926594	missense	probably damaging	1.00
IGL02097:Csmd1	APN	8	16211759	missense	probably null	0.17
IGL02112:Csmd1	APN	8	16081705	missense	probably benign	0.18
IGL02161:Csmd1	APN	8	16358412	missense	probably damaging	0.97
IGL02189:Csmd1	APN	8	16271606	missense	probably damaging	0.99
IGL02272:Csmd1	APN	8	16199893	missense	probably damaging	0.99
IGL02292:Csmd1	APN	8	16211870	missense	probably damaging	1.00
IGL02385:Csmd1	APN	8	15903275	missense	probably benign	0.08
IGL02424:Csmd1	APN	8	16092326	missense	probably benign	0.22
IGL02492:Csmd1	APN	8	16002597	missense	probably benign	0.13
IGL02507:Csmd1	APN	8	17534976	utr 5 prime	probably benign
IGL02513:Csmd1	APN	8	15999869	splice site	probably benign
IGL02727:Csmd1	APN	8	16231327	missense	probably damaging	1.00
IGL02728:Csmd1	APN	8	15999779	critical splice donor site	probably null
IGL02852:Csmd1	APN	8	15895728	missense	probably damaging	0.99
IGL02935:Csmd1	APN	8	16223334	missense	probably damaging	1.00
IGL02945:Csmd1	APN	8	16271570	missense	possibly damaging	0.92
IGL02959:Csmd1	APN	8	15910465	missense	probably damaging	0.99
IGL03113:Csmd1	APN	8	16028698	missense	probably benign
IGL03129:Csmd1	APN	8	15961521	missense	probably damaging	0.99
IGL03131:Csmd1	APN	8	16088217	missense	probably damaging	1.00
IGL03275:Csmd1	APN	8	16157092	missense	probably benign	0.00
IGL03297:Csmd1	APN	8	16009432	nonsense	probably null
ikura	UTSW	8	16231271	missense	probably damaging	1.00
I2289:Csmd1	UTSW	8	15912381	missense	probably benign	0.10
IGL03055:Csmd1	UTSW	8	16095501	missense	probably damaging	1.00
IGL03097:Csmd1	UTSW	8	15945127	missense	probably damaging	1.00
PIT4260001:Csmd1	UTSW	8	16070313	missense	probably damaging	1.00
PIT4378001:Csmd1	UTSW	8	15895728	missense	probably damaging	0.99
PIT4520001:Csmd1	UTSW	8	15906023	missense	probably benign	0.01
R0037:Csmd1	UTSW	8	15917248	missense	probably damaging	0.97
R0095:Csmd1	UTSW	8	16233051	missense	probably damaging	1.00
R0113:Csmd1	UTSW	8	15984849	missense	probably damaging	1.00
R0129:Csmd1	UTSW	8	16079942	missense	possibly damaging	0.95
R0144:Csmd1	UTSW	8	16391824	missense	probably benign	0.16
R0166:Csmd1	UTSW	8	16233022	missense	probably benign	0.29
R0227:Csmd1	UTSW	8	16391822	missense	probably benign	0.05
R0279:Csmd1	UTSW	8	16223235	missense	probably damaging	0.99
R0280:Csmd1	UTSW	8	16271602	missense	probably damaging	1.00
R0312:Csmd1	UTSW	8	15984760	missense	probably damaging	1.00
R0355:Csmd1	UTSW	8	15918330	missense	probably damaging	0.97
R0367:Csmd1	UTSW	8	15917270	missense	probably damaging	1.00
R0395:Csmd1	UTSW	8	16346638	missense	probably damaging	0.99
R0413:Csmd1	UTSW	8	16710514	missense	probably damaging	0.97
R0457:Csmd1	UTSW	8	16501393	critical splice acceptor site	probably null
R0463:Csmd1	UTSW	8	15921759	missense	probably damaging	0.99
R0482:Csmd1	UTSW	8	16233101	missense	probably damaging	1.00
R0501:Csmd1	UTSW	8	17027323	missense	probably damaging	0.97
R0507:Csmd1	UTSW	8	16185344	splice site	probably benign
R0511:Csmd1	UTSW	8	15932529	missense	possibly damaging	0.80
R0555:Csmd1	UTSW	8	16185273	missense	probably benign
R0580:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R0610:Csmd1	UTSW	8	15918208	missense	possibly damaging	0.95
R0634:Csmd1	UTSW	8	16226391	missense	probably damaging	1.00
R0666:Csmd1	UTSW	8	16069049	missense	possibly damaging	0.88
R0674:Csmd1	UTSW	8	16000550	missense	probably benign	0.03
R0675:Csmd1	UTSW	8	16158131	missense	probably benign	0.01
R0763:Csmd1	UTSW	8	17027284	missense	possibly damaging	0.67
R0781:Csmd1	UTSW	8	15921174	missense	probably benign	0.35
R0862:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0864:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0925:Csmd1	UTSW	8	16710618	missense	probably benign	0.29
R0926:Csmd1	UTSW	8	16033576	splice site	probably null
R1005:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R1073:Csmd1	UTSW	8	16358463	splice site	probably benign
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1256:Csmd1	UTSW	8	16079964	missense	probably damaging	1.00
R1294:Csmd1	UTSW	8	16698036	missense	probably damaging	0.99
R1375:Csmd1	UTSW	8	16463081	splice site	probably null
R1447:Csmd1	UTSW	8	15925306	nonsense	probably null
R1450:Csmd1	UTSW	8	15945180	critical splice acceptor site	probably null
R1470:Csmd1	UTSW	8	16157204	splice site	probably benign
R1580:Csmd1	UTSW	8	15925299	missense	probably damaging	1.00
R1591:Csmd1	UTSW	8	15900710	missense	probably damaging	0.99
R1658:Csmd1	UTSW	8	16081725	missense	possibly damaging	0.69
R1678:Csmd1	UTSW	8	15918252	missense	possibly damaging	0.58
R1717:Csmd1	UTSW	8	17216692	missense	possibly damaging	0.58
R1735:Csmd1	UTSW	8	15932610	missense	probably damaging	0.99
R1750:Csmd1	UTSW	8	15917303	missense	probably damaging	0.99
R1753:Csmd1	UTSW	8	16157120	nonsense	probably null
R1822:Csmd1	UTSW	8	16223326	missense	probably damaging	1.00
R1875:Csmd1	UTSW	8	15929101	missense	probably damaging	0.99
R1909:Csmd1	UTSW	8	15906116	missense	probably damaging	1.00
R1912:Csmd1	UTSW	8	16233998	critical splice donor site	probably null
R1993:Csmd1	UTSW	8	16346684	missense	probably damaging	0.99
R2067:Csmd1	UTSW	8	15900782	missense	probably benign
R2094:Csmd1	UTSW	8	16079978	missense	probably damaging	0.99
R2119:Csmd1	UTSW	8	17216733	missense	probably damaging	0.98
R2127:Csmd1	UTSW	8	15917392	missense	probably damaging	1.00
R2138:Csmd1	UTSW	8	15929088	missense	probably damaging	0.96
R2216:Csmd1	UTSW	8	17027339	critical splice acceptor site	probably null
R2220:Csmd1	UTSW	8	15992641	missense	possibly damaging	0.94
R2380:Csmd1	UTSW	8	16190087	missense	probably damaging	1.00
R2471:Csmd1	UTSW	8	16211762	missense	probably damaging	1.00
R2984:Csmd1	UTSW	8	15953782	missense	probably damaging	1.00
R3001:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3002:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3003:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3103:Csmd1	UTSW	8	15917405	missense	probably damaging	1.00
R3104:Csmd1	UTSW	8	17027231	missense	probably damaging	1.00
R3620:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3621:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3748:Csmd1	UTSW	8	15906071	missense	probably damaging	0.99
R3780:Csmd1	UTSW	8	16201986	missense	probably damaging	1.00
R3815:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3816:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3818:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3819:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3850:Csmd1	UTSW	8	16079922	missense	probably benign	0.00
R3945:Csmd1	UTSW	8	15910619	splice site	probably null
R3980:Csmd1	UTSW	8	15906056	nonsense	probably null
R4061:Csmd1	UTSW	8	15945158	missense	probably benign	0.00
R4086:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4087:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4089:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4183:Csmd1	UTSW	8	15910464	missense	probably damaging	0.99
R4226:Csmd1	UTSW	8	16000490	missense	probably damaging	0.99
R4454:Csmd1	UTSW	8	15945011	missense	probably damaging	0.99
R4533:Csmd1	UTSW	8	15931037	splice site	probably null
R4544:Csmd1	UTSW	8	16710636	missense	possibly damaging	0.93
R4547:Csmd1	UTSW	8	16391797	missense	possibly damaging	0.48
R4612:Csmd1	UTSW	8	15921908	splice site	probably null
R4620:Csmd1	UTSW	8	16002694	critical splice acceptor site	probably null
R4627:Csmd1	UTSW	8	16697917	missense	probably benign	0.00
R4633:Csmd1	UTSW	8	16002620	missense	probably damaging	0.99
R4646:Csmd1	UTSW	8	15932511	missense	possibly damaging	0.87
R4648:Csmd1	UTSW	8	15998788	nonsense	probably null
R4668:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.50
R4709:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.96
R4709:Csmd1	UTSW	8	16710506	critical splice donor site	probably null
R4741:Csmd1	UTSW	8	15910447	missense	probably damaging	0.99
R4774:Csmd1	UTSW	8	16009369	missense	probably benign	0.11
R4793:Csmd1	UTSW	8	16088263	missense	probably damaging	1.00
R4829:Csmd1	UTSW	8	16127296	missense	probably damaging	1.00
R4888:Csmd1	UTSW	8	15895674	utr 3 prime	probably benign
R4896:Csmd1	UTSW	8	16009439	missense	probably benign	0.00
R4932:Csmd1	UTSW	8	16023765	missense	probably damaging	0.99
R4944:Csmd1	UTSW	8	15998772	missense	probably damaging	1.00
R4953:Csmd1	UTSW	8	16199917	missense	probably damaging	0.99
R4996:Csmd1	UTSW	8	15910452	missense	probably damaging	0.97
R5028:Csmd1	UTSW	8	15989090	missense	probably damaging	1.00
R5146:Csmd1	UTSW	8	16196190	missense	probably damaging	1.00
R5272:Csmd1	UTSW	8	16199944	missense	probably damaging	0.99
R5327:Csmd1	UTSW	8	17216712	missense	possibly damaging	0.94
R5399:Csmd1	UTSW	8	16710597	missense	probably damaging	1.00
R5411:Csmd1	UTSW	8	15910471	missense	probably damaging	1.00
R5462:Csmd1	UTSW	8	15961486	missense	probably benign	0.12
R5463:Csmd1	UTSW	8	15984860	missense	probably benign	0.34
R5497:Csmd1	UTSW	8	16085181	missense	probably benign	0.20
R5536:Csmd1	UTSW	8	16288660	missense	probably damaging	0.99
R5711:Csmd1	UTSW	8	15953703	missense	probably damaging	1.00
R5730:Csmd1	UTSW	8	16185192	nonsense	probably null
R5788:Csmd1	UTSW	8	16201966	missense	probably damaging	1.00
R5941:Csmd1	UTSW	8	15932471	missense	probably damaging	0.99
R5960:Csmd1	UTSW	8	16071416	missense	possibly damaging	0.68
R5961:Csmd1	UTSW	8	16070352	missense	probably damaging	0.99
R5969:Csmd1	UTSW	8	16071353	missense	probably benign	0.00
R5998:Csmd1	UTSW	8	15910443	missense	probably damaging	1.00
R6062:Csmd1	UTSW	8	16092305	missense	possibly damaging	0.68
R6109:Csmd1	UTSW	8	16199860	missense	possibly damaging	0.93
R6116:Csmd1	UTSW	8	16211850	missense	probably damaging	1.00
R6143:Csmd1	UTSW	8	16088301	missense	probably damaging	1.00
R6155:Csmd1	UTSW	8	15903231	missense	probably benign	0.01
R6197:Csmd1	UTSW	8	15926611	missense	probably benign	0.32
R6247:Csmd1	UTSW	8	16196235	missense	possibly damaging	0.91
R6304:Csmd1	UTSW	8	16058674	missense	probably damaging	1.00
R6317:Csmd1	UTSW	8	16710642	missense	possibly damaging	0.89
R6318:Csmd1	UTSW	8	15903212	missense	probably damaging	1.00
R6338:Csmd1	UTSW	8	15932492	missense	possibly damaging	0.75
R6369:Csmd1	UTSW	8	17535004	start gained	probably benign
R6447:Csmd1	UTSW	8	15910527	missense	probably damaging	1.00
R6454:Csmd1	UTSW	8	15921150	missense	probably damaging	0.99
R6494:Csmd1	UTSW	8	16211695	splice site	probably null
R6614:Csmd1	UTSW	8	17216787	missense	probably damaging	1.00
R6736:Csmd1	UTSW	8	16002626	missense	probably damaging	0.99
R6769:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6771:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6804:Csmd1	UTSW	8	16037246	missense	probably damaging	1.00
R6818:Csmd1	UTSW	8	16185327	missense	probably damaging	1.00
R6863:Csmd1	UTSW	8	17534913	missense	possibly damaging	0.85
R6930:Csmd1	UTSW	8	16092395	missense	probably damaging	0.97
R6969:Csmd1	UTSW	8	17216789	missense	possibly damaging	0.94
R7112:Csmd1	UTSW	8	16101128	missense	probably damaging	1.00
R7124:Csmd1	UTSW	8	15903202	missense	probably damaging	1.00
R7167:Csmd1	UTSW	8	15926524	missense	probably benign
R7243:Csmd1	UTSW	8	15915357	missense	probably damaging	1.00
R7260:Csmd1	UTSW	8	16000574	missense	probably damaging	1.00
R7271:Csmd1	UTSW	8	17027279	missense	probably damaging	0.99
R7324:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7325:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7327:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7373:Csmd1	UTSW	8	15992713	missense	probably damaging	1.00
R7406:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R7427:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7428:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7445:Csmd1	UTSW	8	16158254	missense	possibly damaging	0.61
R7458:Csmd1	UTSW	8	15953738	missense	probably damaging	1.00
R7476:Csmd1	UTSW	8	15895731	missense	probably damaging	1.00
R7527:Csmd1	UTSW	8	16211718	missense	probably damaging	1.00
R7544:Csmd1	UTSW	8	16092296	missense	probably damaging	1.00
R7583:Csmd1	UTSW	8	15998833	missense	probably damaging	0.96
R7603:Csmd1	UTSW	8	16288682	missense	probably damaging	1.00
R7607:Csmd1	UTSW	8	15918331	missense	possibly damaging	0.94
R7642:Csmd1	UTSW	8	16085178	missense	probably damaging	0.99
R7669:Csmd1	UTSW	8	15917273	missense	probably damaging	1.00
R7720:Csmd1	UTSW	8	15931108	missense	probably damaging	1.00
R7728:Csmd1	UTSW	8	16231271	missense	probably damaging	1.00
R7738:Csmd1	UTSW	8	16100990	missense	probably damaging	1.00
R7745:Csmd1	UTSW	8	15932461	critical splice donor site	probably null
R7879:Csmd1	UTSW	8	16391806	missense	probably benign	0.28
R7884:Csmd1	UTSW	8	15961418	missense	probably damaging	1.00
R7897:Csmd1	UTSW	8	17534919	missense	possibly damaging	0.96
R8111:Csmd1	UTSW	8	15917306	missense	probably benign
R8119:Csmd1	UTSW	8	17027294	missense	probably damaging	0.99
R8134:Csmd1	UTSW	8	15932550	missense	probably damaging	0.99
R8187:Csmd1	UTSW	8	16127174	missense	probably damaging	0.99
R8196:Csmd1	UTSW	8	16009468	missense	probably benign	0.18
R8231:Csmd1	UTSW	8	16697923	missense	possibly damaging	0.82
R8242:Csmd1	UTSW	8	16710654	missense	probably benign	0.42
R8274:Csmd1	UTSW	8	15910453	missense	possibly damaging	0.93
R8286:Csmd1	UTSW	8	15989188	missense	probably benign	0.18
R8289:Csmd1	UTSW	8	16058702	missense	probably damaging	0.99
R8314:Csmd1	UTSW	8	16158244	missense	probably benign
R8323:Csmd1	UTSW	8	17216735	nonsense	probably null
R8387:Csmd1	UTSW	8	16000484	missense	possibly damaging	0.94
R8413:Csmd1	UTSW	8	15900676	missense	probably damaging	0.98
R8672:Csmd1	UTSW	8	15926598	missense	probably benign	0.01
R8765:Csmd1	UTSW	8	16710611	nonsense	probably null
R8789:Csmd1	UTSW	8	17216706	missense	probably damaging	0.99
R8828:Csmd1	UTSW	8	15998794	missense	probably benign	0.00
R8858:Csmd1	UTSW	8	16070304	missense	probably benign	0.10
R8878:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R8911:Csmd1	UTSW	8	16698003	missense	probably damaging	0.99
R8966:Csmd1	UTSW	8	16200045	missense	probably damaging	1.00
R8978:Csmd1	UTSW	8	15921056	missense	probably benign	0.37
R8996:Csmd1	UTSW	8	15921105	missense	possibly damaging	0.54
R9045:Csmd1	UTSW	8	16234074	missense	probably damaging	0.99
R9084:Csmd1	UTSW	8	16088311	missense	probably benign
R9124:Csmd1	UTSW	8	15984806	missense	probably damaging	0.99
R9127:Csmd1	UTSW	8	16223272	missense	probably benign	0.31
R9146:Csmd1	UTSW	8	15998832	missense	probably benign	0.00
R9198:Csmd1	UTSW	8	15912430	missense	probably damaging	1.00
R9285:Csmd1	UTSW	8	15906088	missense	probably damaging	1.00
R9303:Csmd1	UTSW	8	15961532	missense	probably benign	0.31
R9305:Csmd1	UTSW	8	15961532	missense	probably benign	0.31
R9326:Csmd1	UTSW	8	15999803	missense	probably benign	0.21
R9356:Csmd1	UTSW	8	16202055	missense	probably damaging	1.00
R9385:Csmd1	UTSW	8	15984756	missense	probably benign	0.19
R9444:Csmd1	UTSW	8	16158236	missense	probably benign	0.30
R9476:Csmd1	UTSW	8	15931215	critical splice acceptor site	probably null
R9506:Csmd1	UTSW	8	16200009	missense	probably damaging	1.00
R9614:Csmd1	UTSW	8	16158225	missense	probably benign	0.00
R9668:Csmd1	UTSW	8	16211758	missense	probably benign	0.00
X0011:Csmd1	UTSW	8	16196263	missense	probably damaging	1.00
X0021:Csmd1	UTSW	8	16185256	missense	probably damaging	1.00
X0024:Csmd1	UTSW	8	16037218	missense	probably damaging	0.99
X0028:Csmd1	UTSW	8	15915333	missense	possibly damaging	0.79
Z1088:Csmd1	UTSW	8	15921875	missense	possibly damaging	0.91
Z1088:Csmd1	UTSW	8	16092258	missense	probably damaging	1.00
Z1088:Csmd1	UTSW	8	16189978	missense	possibly damaging	0.50
Z1088:Csmd1	UTSW	8	16200058	missense	probably damaging	0.97
Z1088:Csmd1	UTSW	8	16346617	missense	probably damaging	0.99
Z1176:Csmd1	UTSW	8	15998814	missense	probably damaging	1.00
Z1176:Csmd1	UTSW	8	16037198	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	15984708	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	16200019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGCTTACCATCAAACACTTCCAG -3'
(R):5'- ACCAATCCTGCTGAAAACTGTGGC -3'

Sequencing Primer
(F):5'- ACTTCCAGTGCATCAAATTGC -3'
(R):5'- CAAACAGTGCAGGTGTGTGTG -3'

Posted On

2013-06-12