Mutagenetix > Incidental Mutation

Incidental Mutation 'R0505:Tenm3'

47478

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

038700-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R0505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 48341160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110346] [ENSMUST00000190840]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033965

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110346

SMART Domains

Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	1.1e-14	PFAM
transmembrane domain	37	59	N/A	INTRINSIC
EGF	245	273	2.32e-1	SMART
EGF_like	276	304	4.11e1	SMART
EGF	309	338	1.69e1	SMART
EGF	341	370	1.35e-2	SMART
EGF	375	405	6.11e-1	SMART
EGF	408	436	7.95e0	SMART
EGF	439	467	1.28e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190840

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (119/121)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,291,058	Y974H	probably benign	Het
Abca2	G	T	2: 25,434,894	G300V	probably benign	Het
Abi1	A	G	2: 22,962,504		probably benign	Het
Actr10	T	A	12: 70,959,964	Y332N	probably damaging	Het
Adam25	G	T	8: 40,755,224	C509F	probably damaging	Het
Adck1	A	T	12: 88,371,691		probably benign	Het
Adgra3	A	G	5: 50,009,334		probably null	Het
Adgrl1	G	T	8: 83,934,650		probably benign	Het
Akr1c21	A	G	13: 4,576,307	Y110C	probably damaging	Het
Arhgef25	T	C	10: 127,183,697	I463V	probably null	Het
Atp6v1e2	C	T	17: 86,944,578	V131M	probably benign	Het
Bdnf	A	G	2: 109,675,343		probably null	Het
C7	A	T	15: 4,994,142		probably benign	Het
Cdc27	T	C	11: 104,528,288	T273A	probably benign	Het
Cdo1	T	A	18: 46,715,611	I187F	probably benign	Het
Cep104	A	T	4: 153,996,304	T742S	probably benign	Het
Ckm	A	T	7: 19,419,452	K223*	probably null	Het
Cmtr1	C	T	17: 29,676,285	P586L	probably benign	Het
Csmd1	C	T	8: 15,992,758	R2325Q	probably damaging	Het
Dcpp1	A	T	17: 23,882,594	I106L	possibly damaging	Het
Diaph3	A	C	14: 87,090,964		probably benign	Het
Dnah11	A	G	12: 118,106,510	V1520A	probably damaging	Het
Dnajc25	T	A	4: 59,020,438	M168K		Het
Dpp3	T	C	19: 4,914,654	N542D	probably damaging	Het
Ebf2	A	T	14: 67,371,736	K199*	probably null	Het
Efcab11	T	A	12: 99,719,035	Q160L	probably benign	Het
Eif2ak4	T	A	2: 118,431,036	S686T	probably benign	Het
Epha6	C	T	16: 60,205,732	S449N	possibly damaging	Het
Ercc4	T	C	16: 13,126,467	V329A	probably benign	Het
Faf1	T	C	4: 109,840,403	F309L	possibly damaging	Het
Fam102b	T	C	3: 108,980,204	E248G	probably benign	Het
G6pd2	C	A	5: 61,809,567	D228E	probably benign	Het
Ggt1	T	G	10: 75,585,957	V546G	probably damaging	Het
Gm14139	T	A	2: 150,193,080	C471*	probably null	Het
Gpatch4	G	T	3: 88,051,217	V3F	probably damaging	Het
Gprin3	A	G	6: 59,353,387	L645P	probably damaging	Het
Hyal2	A	G	9: 107,572,071	Y342C	probably benign	Het
Igf2bp2	A	G	16: 22,089,099	I16T	possibly damaging	Het
Inca1	T	C	11: 70,690,199	Y61C	probably damaging	Het
Ipo5	T	C	14: 120,942,733	W860R	possibly damaging	Het
Kcnj9	C	T	1: 172,323,024	A341T	probably benign	Het
Kdm5b	T	C	1: 134,602,571	V440A	probably damaging	Het
L3mbtl1	C	T	2: 162,947,335		probably benign	Het
Lin54	G	A	5: 100,452,293	T307I	probably damaging	Het
Lrrc18	C	A	14: 33,009,139	Q212K	probably benign	Het
Lrrc37a	A	G	11: 103,503,025	S525P	probably benign	Het
Lrrc71	T	A	3: 87,745,699	S137C	probably damaging	Het
Lrrk1	A	T	7: 66,290,908		probably null	Het
Man2b2	G	A	5: 36,816,198	S58L	probably benign	Het
Masp1	T	A	16: 23,458,138	H539L	probably benign	Het
Med1	G	A	11: 98,156,904	P1022L	probably damaging	Het
Meis1	T	A	11: 19,011,360	H171L	probably damaging	Het
Mier1	T	A	4: 103,155,623		probably benign	Het
Mkl2	C	T	16: 13,412,526	T1025I	possibly damaging	Het
Mmp13	A	T	9: 7,272,929	R96S	probably damaging	Het
Mms19	G	A	19: 41,953,734	T38I	probably damaging	Het
Mrc1	G	A	2: 14,310,032	C976Y	probably damaging	Het
Naalad2	A	G	9: 18,385,895	Y32H	probably benign	Het
Ndufs1	A	G	1: 63,143,926		probably benign	Het
Nefm	C	T	14: 68,124,159	D219N	probably damaging	Het
Nwd1	C	T	8: 72,662,337	P172L	probably damaging	Het
Nwd2	T	A	5: 63,805,111	D679E	probably damaging	Het
Ogdh	T	A	11: 6,339,936		probably benign	Het
Olfm3	T	A	3: 115,122,681	S421T	possibly damaging	Het
Olfr1281	A	T	2: 111,329,328	N303I	probably benign	Het
Olfr1445	T	C	19: 12,884,079	L66P	probably damaging	Het
Olfr1445	A	G	19: 12,884,546	T222A	probably damaging	Het
Olfr559	T	A	7: 102,724,029	I154F	probably damaging	Het
Olfr628	T	C	7: 103,732,376	V150A	probably benign	Het
Olfr988	A	G	2: 85,353,749	M59T	possibly damaging	Het
Opn5	T	G	17: 42,592,953	T164P	possibly damaging	Het
Pde7b	C	T	10: 20,438,746	V166M	probably damaging	Het
Pik3ap1	T	C	19: 41,324,564	N370S	probably damaging	Het
Pkhd1l1	A	T	15: 44,589,418	D3913V	probably damaging	Het
Pld1	A	G	3: 28,120,822	I90V	possibly damaging	Het
Plxna2	A	G	1: 194,644,348	T197A	possibly damaging	Het
Plxna4	A	T	6: 32,202,119	M987K	probably benign	Het
Pmch	A	G	10: 88,091,359	N75D	probably benign	Het
Prom2	T	A	2: 127,532,867	Q583L	possibly damaging	Het
Pyroxd1	T	A	6: 142,353,562	M148K	possibly damaging	Het
R3hdm2	C	T	10: 127,457,700	L158F	probably damaging	Het
Rapgef6	A	T	11: 54,625,963	T349S	probably benign	Het
Rfx5	C	T	3: 94,956,355	T105I	probably damaging	Het
Rif1	C	A	2: 52,110,737	P1401Q	probably damaging	Het
Robo3	G	A	9: 37,416,759		probably benign	Het
Rpn1	T	A	6: 88,090,242	S195T	probably benign	Het
Rslcan18	C	A	13: 67,102,119	K17N	probably benign	Het
Rsph3b	A	T	17: 6,941,727	I48N	probably damaging	Het
Sbf2	A	T	7: 110,399,343	Y628N	probably damaging	Het
Sis	T	C	3: 72,960,296	T139A	probably benign	Het
Slc22a14	A	G	9: 119,172,034		probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Smarcb1	T	C	10: 75,897,066	T372A	probably damaging	Het
Spidr	T	A	16: 16,037,667	H328L	probably damaging	Het
Sun5	T	A	2: 153,870,952	D16V	probably damaging	Het
Syde2	G	A	3: 146,014,380	E1053K	possibly damaging	Het
Syne2	T	C	12: 76,099,464	S6419P	probably damaging	Het
Timm44	C	A	8: 4,260,532	E407*	probably null	Het
Tmem189	A	T	2: 167,644,987		probably benign	Het
Tnpo2	A	G	8: 85,047,362	T342A	probably benign	Het
Trio	A	G	15: 27,767,907	C1964R	probably benign	Het
Trip11	A	C	12: 101,885,672	L711R	probably damaging	Het
Trp53bp1	A	T	2: 121,269,969	H101Q	probably damaging	Het
Trpm6	A	G	19: 18,873,902		probably benign	Het
Ttn	A	T	2: 76,849,991		probably benign	Het
Ucp1	T	A	8: 83,295,307	M256K	possibly damaging	Het
Uhrf1bp1l	T	C	10: 89,791,443	S145P	probably damaging	Het
Unc5a	T	A	13: 55,004,954	S838T	probably damaging	Het
Uxs1	T	C	1: 43,764,886		probably null	Het
Vmn2r108	A	T	17: 20,462,834	C703S	possibly damaging	Het
Zc3hav1	C	T	6: 38,332,664	G408R	probably damaging	Het
Zfp609	G	A	9: 65,703,462	L740F	possibly damaging	Het
Zfp69	T	C	4: 120,931,095	E341G	probably damaging	Het
Zfp707	A	T	15: 75,975,256	H312L	probably damaging	Het
Zfp773	T	C	7: 7,133,024	D191G	probably benign	Het
Zgrf1	C	A	3: 127,573,238	D755E	probably benign	Het
Zscan5b	T	A	7: 6,239,075	I431N	probably damaging	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
R9509:Tenm3	UTSW	8	48313257	nonsense	probably null
R9575:Tenm3	UTSW	8	48235761	missense	possibly damaging	0.94
R9698:Tenm3	UTSW	8	48236211	missense	probably damaging	1.00
R9722:Tenm3	UTSW	8	48300814	missense	probably benign	0.00
R9788:Tenm3	UTSW	8	48335561	missense	probably benign	0.02
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGCTTTCTTGAAGGTAAGTCCCG -3'
(R):5'- AGAGCAACTGTCTGAGACCTGGAG -3'

Sequencing Primer
(F):5'- TAAGTCCCGTGGCCTGAG -3'
(R):5'- GGGTCTCAATTACCTAAATGGCG -3'

Posted On

2013-06-12