Incidental Mutation 'R3945:Zfp988'
ID474786
Institutional Source Beutler Lab
Gene Symbol Zfp988
Ensembl Gene ENSMUSG00000078498
Gene Namezinc finger protein 988
SynonymsGm13151
MMRRC Submission 040926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3945 (G1)
Quality Score35
Status Validated
Chromosome4
Chromosomal Location147305674-147333734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 147332785 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 559 (K559Q)
Ref Sequence ENSEMBL: ENSMUSP00000120413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148762] [ENSMUST00000166764]
Predicted Effect probably benign
Transcript: ENSMUST00000148762
AA Change: K559Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120413
Gene: ENSMUSG00000078498
AA Change: K559Q

DomainStartEndE-ValueType
KRAB 13 76 4.74e-16 SMART
ZnF_C2H2 240 262 2.61e-4 SMART
ZnF_C2H2 268 290 1.3e-4 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 7.78e-3 SMART
ZnF_C2H2 352 374 1.3e-4 SMART
ZnF_C2H2 380 402 8.34e-3 SMART
ZnF_C2H2 408 430 2.79e-4 SMART
ZnF_C2H2 436 458 3.74e-5 SMART
ZnF_C2H2 464 486 1.3e-4 SMART
ZnF_C2H2 492 514 1.5e-4 SMART
ZnF_C2H2 520 542 2.43e-4 SMART
ZnF_C2H2 548 570 9.73e-4 SMART
ZnF_C2H2 576 598 1.56e-2 SMART
ZnF_C2H2 604 626 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181752
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Other mutations in Zfp988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zfp988 APN 4 147331668 nonsense probably null
R1672:Zfp988 UTSW 4 147331282 missense probably benign
R1834:Zfp988 UTSW 4 147332887 missense probably damaging 0.97
R2324:Zfp988 UTSW 4 147332785 missense probably benign
R2380:Zfp988 UTSW 4 147332785 missense probably benign
R3795:Zfp988 UTSW 4 147331583 missense possibly damaging 0.51
R4024:Zfp988 UTSW 4 147332785 missense probably benign
R5012:Zfp988 UTSW 4 147331603 missense probably benign
R5059:Zfp988 UTSW 4 147331915 nonsense probably null
R6008:Zfp988 UTSW 4 147331802 missense probably benign 0.16
R6245:Zfp988 UTSW 4 147332013 nonsense probably null
R6549:Zfp988 UTSW 4 147331853 missense probably benign 0.03
R7658:Zfp988 UTSW 4 147332294 missense probably damaging 1.00
R8309:Zfp988 UTSW 4 147332308 missense probably damaging 0.99
R8439:Zfp988 UTSW 4 147332351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAATGAATGTGGCAAATGCTTTAC -3'
(R):5'- TCACTGTTACAGTCTAGGAAATAGGCC -3'

Sequencing Primer
(F):5'- cagtgaatgtggcaaatgc -3'
(R):5'- TGAATACCAAGATGGAATTTTCGGG -3'
Posted On2017-04-14