Incidental Mutation 'R0505:Naalad2'
ID47484
Institutional Source Beutler Lab
Gene Symbol Naalad2
Ensembl Gene ENSMUSG00000043943
Gene NameN-acetylated alpha-linked acidic dipeptidase 2
SynonymsNAADALASE2, GCP3, NAALADASE2, Folh1b, GCPIII, D9Ertd285e
MMRRC Submission 038700-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R0505 (G1)
Quality Score144
Status Validated
Chromosome9
Chromosomal Location18321951-18402995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18385895 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 32 (Y32H)
Ref Sequence ENSEMBL: ENSMUSP00000130752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001826] [ENSMUST00000101453] [ENSMUST00000164081] [ENSMUST00000166825] [ENSMUST00000172116] [ENSMUST00000172171]
Predicted Effect probably benign
Transcript: ENSMUST00000001826
AA Change: Y32H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001826
Gene: ENSMUSG00000043943
AA Change: Y32H

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 198 290 2.2e-14 PFAM
Pfam:Peptidase_M28 385 593 9.4e-22 PFAM
Pfam:TFR_dimer 655 775 1.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101453
AA Change: Y32H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000164081
Predicted Effect probably benign
Transcript: ENSMUST00000166825
SMART Domains Protein: ENSMUSP00000128674
Gene: ENSMUSG00000043943

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PA 155 253 2.8e-14 PFAM
Pfam:Peptidase_M28 360 554 8.2e-18 PFAM
Pfam:TFR_dimer 616 739 3.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168934
Predicted Effect probably benign
Transcript: ENSMUST00000172116
AA Change: Y32H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133157
Gene: ENSMUSG00000043943
AA Change: Y32H

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172171
AA Change: Y32H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130752
Gene: ENSMUSG00000043943
AA Change: Y32H

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 193 291 3.5e-14 PFAM
Pfam:Peptidase_M28 398 592 1.2e-17 PFAM
Pfam:TFR_dimer 654 777 6.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172200
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (119/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-acetylated alpha-linked acidic dipeptidase (NAALADase) gene family. The representative member of this family is the gene encoding human prostate-specific membrane antigen (PSM), which is a marker of prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,291,058 Y974H probably benign Het
Abca2 G T 2: 25,434,894 G300V probably benign Het
Abi1 A G 2: 22,962,504 probably benign Het
Actr10 T A 12: 70,959,964 Y332N probably damaging Het
Adam25 G T 8: 40,755,224 C509F probably damaging Het
Adck1 A T 12: 88,371,691 probably benign Het
Adgra3 A G 5: 50,009,334 probably null Het
Adgrl1 G T 8: 83,934,650 probably benign Het
Akr1c21 A G 13: 4,576,307 Y110C probably damaging Het
Arhgef25 T C 10: 127,183,697 I463V probably null Het
Atp6v1e2 C T 17: 86,944,578 V131M probably benign Het
Bdnf A G 2: 109,675,343 probably null Het
C7 A T 15: 4,994,142 probably benign Het
Cdc27 T C 11: 104,528,288 T273A probably benign Het
Cdo1 T A 18: 46,715,611 I187F probably benign Het
Cep104 A T 4: 153,996,304 T742S probably benign Het
Ckm A T 7: 19,419,452 K223* probably null Het
Cmtr1 C T 17: 29,676,285 P586L probably benign Het
Csmd1 C T 8: 15,992,758 R2325Q probably damaging Het
Dcpp1 A T 17: 23,882,594 I106L possibly damaging Het
Diaph3 A C 14: 87,090,964 probably benign Het
Dnah11 A G 12: 118,106,510 V1520A probably damaging Het
Dnajc25 T A 4: 59,020,438 M168K possibly damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Ebf2 A T 14: 67,371,736 K199* probably null Het
Efcab11 T A 12: 99,719,035 Q160L probably benign Het
Eif2ak4 T A 2: 118,431,036 S686T probably benign Het
Epha6 C T 16: 60,205,732 S449N possibly damaging Het
Ercc4 T C 16: 13,126,467 V329A probably benign Het
Faf1 T C 4: 109,840,403 F309L possibly damaging Het
Fam102b T C 3: 108,980,204 E248G probably benign Het
G6pd2 C A 5: 61,809,567 D228E probably benign Het
Ggt1 T G 10: 75,585,957 V546G probably damaging Het
Gm14139 T A 2: 150,193,080 C471* probably null Het
Gpatch4 G T 3: 88,051,217 V3F probably damaging Het
Gprin3 A G 6: 59,353,387 L645P probably damaging Het
Hyal2 A G 9: 107,572,071 Y342C probably benign Het
Igf2bp2 A G 16: 22,089,099 I16T possibly damaging Het
Inca1 T C 11: 70,690,199 Y61C probably damaging Het
Ipo5 T C 14: 120,942,733 W860R possibly damaging Het
Kcnj9 C T 1: 172,323,024 A341T probably benign Het
Kdm5b T C 1: 134,602,571 V440A probably damaging Het
L3mbtl1 C T 2: 162,947,335 probably benign Het
Lin54 G A 5: 100,452,293 T307I probably damaging Het
Lrrc18 C A 14: 33,009,139 Q212K probably benign Het
Lrrc37a A G 11: 103,503,025 S525P probably benign Het
Lrrc71 T A 3: 87,745,699 S137C probably damaging Het
Lrrk1 A T 7: 66,290,908 probably null Het
Man2b2 G A 5: 36,816,198 S58L probably benign Het
Masp1 T A 16: 23,458,138 H539L probably benign Het
Med1 G A 11: 98,156,904 P1022L probably damaging Het
Meis1 T A 11: 19,011,360 H171L probably damaging Het
Mier1 T A 4: 103,155,623 probably benign Het
Mkl2 C T 16: 13,412,526 T1025I possibly damaging Het
Mmp13 A T 9: 7,272,929 R96S probably damaging Het
Mms19 G A 19: 41,953,734 T38I probably damaging Het
Mrc1 G A 2: 14,310,032 C976Y probably damaging Het
Ndufs1 A G 1: 63,143,926 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Nwd2 T A 5: 63,805,111 D679E probably damaging Het
Ogdh T A 11: 6,339,936 probably benign Het
Olfm3 T A 3: 115,122,681 S421T possibly damaging Het
Olfr1281 A T 2: 111,329,328 N303I probably benign Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr559 T A 7: 102,724,029 I154F probably damaging Het
Olfr628 T C 7: 103,732,376 V150A probably benign Het
Olfr988 A G 2: 85,353,749 M59T possibly damaging Het
Opn5 T G 17: 42,592,953 T164P possibly damaging Het
Pde7b C T 10: 20,438,746 V166M probably damaging Het
Pik3ap1 T C 19: 41,324,564 N370S probably damaging Het
Pkhd1l1 A T 15: 44,589,418 D3913V probably damaging Het
Pld1 A G 3: 28,120,822 I90V possibly damaging Het
Plxna2 A G 1: 194,644,348 T197A possibly damaging Het
Plxna4 A T 6: 32,202,119 M987K probably benign Het
Pmch A G 10: 88,091,359 N75D probably benign Het
Prom2 T A 2: 127,532,867 Q583L possibly damaging Het
Pyroxd1 T A 6: 142,353,562 M148K possibly damaging Het
R3hdm2 C T 10: 127,457,700 L158F probably damaging Het
Rapgef6 A T 11: 54,625,963 T349S probably benign Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rif1 C A 2: 52,110,737 P1401Q probably damaging Het
Robo3 G A 9: 37,416,759 probably benign Het
Rpn1 T A 6: 88,090,242 S195T probably benign Het
Rslcan18 C A 13: 67,102,119 K17N probably benign Het
Rsph3b A T 17: 6,941,727 I48N probably damaging Het
Sbf2 A T 7: 110,399,343 Y628N probably damaging Het
Sis T C 3: 72,960,296 T139A probably benign Het
Slc22a14 A G 9: 119,172,034 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Smarcb1 T C 10: 75,897,066 T372A probably damaging Het
Spidr T A 16: 16,037,667 H328L probably damaging Het
Sun5 T A 2: 153,870,952 D16V probably damaging Het
Syde2 G A 3: 146,014,380 E1053K possibly damaging Het
Syne2 T C 12: 76,099,464 S6419P probably damaging Het
Tenm3 G A 8: 48,341,160 probably benign Het
Timm44 C A 8: 4,260,532 E407* probably null Het
Tmem189 A T 2: 167,644,987 probably benign Het
Tnpo2 A G 8: 85,047,362 T342A probably benign Het
Trio A G 15: 27,767,907 C1964R probably benign Het
Trip11 A C 12: 101,885,672 L711R probably damaging Het
Trp53bp1 A T 2: 121,269,969 H101Q probably damaging Het
Trpm6 A G 19: 18,873,902 probably benign Het
Ttn A T 2: 76,849,991 probably benign Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Uhrf1bp1l T C 10: 89,791,443 S145P probably damaging Het
Unc5a T A 13: 55,004,954 S838T probably damaging Het
Uxs1 T C 1: 43,764,886 probably null Het
Vmn2r108 A T 17: 20,462,834 C703S possibly damaging Het
Zc3hav1 C T 6: 38,332,664 G408R probably damaging Het
Zfp609 G A 9: 65,703,462 L740F possibly damaging Het
Zfp69 T C 4: 120,931,095 E341G probably damaging Het
Zfp707 A T 15: 75,975,256 H312L probably damaging Het
Zfp773 T C 7: 7,133,024 D191G probably benign Het
Zgrf1 C A 3: 127,573,238 D755E probably benign Het
Zscan5b T A 7: 6,239,075 I431N probably damaging Het
Other mutations in Naalad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Naalad2 APN 9 18327373 missense probably damaging 0.97
IGL02160:Naalad2 APN 9 18379937 missense probably damaging 1.00
IGL03246:Naalad2 APN 9 18385099 missense possibly damaging 0.92
IGL03351:Naalad2 APN 9 18364187 missense possibly damaging 0.57
ithaca UTSW 9 18378699 missense probably damaging 1.00
odysseus UTSW 9 18376533 missense possibly damaging 0.63
R0112:Naalad2 UTSW 9 18351447 nonsense probably null
R0266:Naalad2 UTSW 9 18350943 splice site probably benign
R1077:Naalad2 UTSW 9 18347506 missense probably damaging 1.00
R1442:Naalad2 UTSW 9 18351032 splice site probably benign
R1553:Naalad2 UTSW 9 18378669 missense probably benign 0.01
R1694:Naalad2 UTSW 9 18327387 missense probably damaging 0.96
R1912:Naalad2 UTSW 9 18376535 missense probably benign 0.00
R1976:Naalad2 UTSW 9 18378699 missense probably damaging 1.00
R2224:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2225:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2227:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2287:Naalad2 UTSW 9 18335021 splice site probably null
R4126:Naalad2 UTSW 9 18347470 missense probably damaging 1.00
R4784:Naalad2 UTSW 9 18350918 missense probably damaging 1.00
R5426:Naalad2 UTSW 9 18347519 missense probably benign 0.11
R5470:Naalad2 UTSW 9 18330851 missense probably damaging 1.00
R5644:Naalad2 UTSW 9 18334931 missense possibly damaging 0.90
R5888:Naalad2 UTSW 9 18330641 missense probably benign 0.34
R6194:Naalad2 UTSW 9 18351147 missense probably benign 0.23
R6238:Naalad2 UTSW 9 18385065 missense probably damaging 1.00
R6701:Naalad2 UTSW 9 18385148 missense probably null 0.05
R6764:Naalad2 UTSW 9 18402889 start gained probably benign
R6791:Naalad2 UTSW 9 18385130 missense possibly damaging 0.67
R7133:Naalad2 UTSW 9 18327377 missense probably benign 0.00
R7137:Naalad2 UTSW 9 18323487 missense probably benign 0.00
R7212:Naalad2 UTSW 9 18364041 intron probably null
R7588:Naalad2 UTSW 9 18351479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTTGGGAACTCCTCCGAACACATC -3'
(R):5'- GTGTGAGCTTTGCAGTGAAAACACC -3'

Sequencing Primer
(F):5'- TCCGAACACATCCCAGCC -3'
(R):5'- GACAAAAGGCCCTGATTTCTG -3'
Posted On2013-06-12