Mutagenetix > Incidental Mutation

Incidental Mutation 'R0505:Pkhd1l1'

47519

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1l1

Ensembl Gene

ENSMUSG00000038725

Gene Name

polycystic kidney and hepatic disease 1-like 1

Synonyms

PKHDL1, D86 mRNA, fibrocystin L

MMRRC Submission

038700-MU

Accession Numbers

Genbank: NM_138674; MGI: 2183153

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44457494-44601369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44589418 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 3913 (D3913V)

Ref Sequence

ENSEMBL: ENSMUSP00000129522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000038336
AA Change: D3913V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: D3913V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	1.6e-16	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1322	1.1e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	5.1e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	2.1e-10	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166957
AA Change: D3913V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: D3913V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IPT	30	141	9.02e-3	SMART
Pfam:TIG	146	255	9.4e-18	PFAM
IPT	269	362	2.27e-8	SMART
PbH1	398	420	2.98e3	SMART
IPT	1066	1154	5.34e-5	SMART
IPT	1156	1235	1.44e-1	SMART
Pfam:TIG	1240	1323	3e-13	PFAM
IPT	1328	1407	7.06e0	SMART
Pfam:TIG	1565	1645	3.7e-11	PFAM
IPT	1657	1743	1.89e-5	SMART
Pfam:TIG	1748	1828	9.7e-12	PFAM
IPT	1829	1910	4.87e-8	SMART
IPT	1914	1997	6.84e-3	SMART
IPT	1998	2085	9.86e-1	SMART
IPT	2089	2176	7.21e-11	SMART
PbH1	2105	2126	1.56e3	SMART
G8	2183	2303	2.37e-59	SMART
PbH1	2484	2506	9.48e3	SMART
PbH1	2507	2529	8.45e2	SMART
PbH1	2565	2587	4.11e3	SMART
PbH1	2664	2686	3.5e3	SMART
PbH1	2732	2755	2.7e3	SMART
Blast:G8	2949	2979	1e-5	BLAST
low complexity region	3014	3025	N/A	INTRINSIC
G8	3035	3173	6.5e-57	SMART
PbH1	3292	3314	1.96e3	SMART
PbH1	3354	3376	3.79e1	SMART
PbH1	3415	3437	4.87e2	SMART
PbH1	3470	3492	8.34e3	SMART
PbH1	3493	3514	5.86e3	SMART
low complexity region	3563	3574	N/A	INTRINSIC
low complexity region	4076	4103	N/A	INTRINSIC
low complexity region	4184	4212	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209244
AA Change: D3913V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209939

Meta Mutation Damage Score

0.7046

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (119/121)

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,291,058	Y974H	probably benign	Het
Abca2	G	T	2: 25,434,894	G300V	probably benign	Het
Abi1	A	G	2: 22,962,504		probably benign	Het
Actr10	T	A	12: 70,959,964	Y332N	probably damaging	Het
Adam25	G	T	8: 40,755,224	C509F	probably damaging	Het
Adck1	A	T	12: 88,371,691		probably benign	Het
Adgra3	A	G	5: 50,009,334		probably null	Het
Adgrl1	G	T	8: 83,934,650		probably benign	Het
Akr1c21	A	G	13: 4,576,307	Y110C	probably damaging	Het
Arhgef25	T	C	10: 127,183,697	I463V	probably null	Het
Atp6v1e2	C	T	17: 86,944,578	V131M	probably benign	Het
Bdnf	A	G	2: 109,675,343		probably null	Het
C7	A	T	15: 4,994,142		probably benign	Het
Cdc27	T	C	11: 104,528,288	T273A	probably benign	Het
Cdo1	T	A	18: 46,715,611	I187F	probably benign	Het
Cep104	A	T	4: 153,996,304	T742S	probably benign	Het
Ckm	A	T	7: 19,419,452	K223*	probably null	Het
Cmtr1	C	T	17: 29,676,285	P586L	probably benign	Het
Csmd1	C	T	8: 15,992,758	R2325Q	probably damaging	Het
Dcpp1	A	T	17: 23,882,594	I106L	possibly damaging	Het
Diaph3	A	C	14: 87,090,964		probably benign	Het
Dnah11	A	G	12: 118,106,510	V1520A	probably damaging	Het
Dnajc25	T	A	4: 59,020,438	M168K		Het
Dpp3	T	C	19: 4,914,654	N542D	probably damaging	Het
Ebf2	A	T	14: 67,371,736	K199*	probably null	Het
Efcab11	T	A	12: 99,719,035	Q160L	probably benign	Het
Eif2ak4	T	A	2: 118,431,036	S686T	probably benign	Het
Epha6	C	T	16: 60,205,732	S449N	possibly damaging	Het
Ercc4	T	C	16: 13,126,467	V329A	probably benign	Het
Faf1	T	C	4: 109,840,403	F309L	possibly damaging	Het
Fam102b	T	C	3: 108,980,204	E248G	probably benign	Het
G6pd2	C	A	5: 61,809,567	D228E	probably benign	Het
Ggt1	T	G	10: 75,585,957	V546G	probably damaging	Het
Gm14139	T	A	2: 150,193,080	C471*	probably null	Het
Gpatch4	G	T	3: 88,051,217	V3F	probably damaging	Het
Gprin3	A	G	6: 59,353,387	L645P	probably damaging	Het
Hyal2	A	G	9: 107,572,071	Y342C	probably benign	Het
Igf2bp2	A	G	16: 22,089,099	I16T	possibly damaging	Het
Inca1	T	C	11: 70,690,199	Y61C	probably damaging	Het
Ipo5	T	C	14: 120,942,733	W860R	possibly damaging	Het
Kcnj9	C	T	1: 172,323,024	A341T	probably benign	Het
Kdm5b	T	C	1: 134,602,571	V440A	probably damaging	Het
L3mbtl1	C	T	2: 162,947,335		probably benign	Het
Lin54	G	A	5: 100,452,293	T307I	probably damaging	Het
Lrrc18	C	A	14: 33,009,139	Q212K	probably benign	Het
Lrrc37a	A	G	11: 103,503,025	S525P	probably benign	Het
Lrrc71	T	A	3: 87,745,699	S137C	probably damaging	Het
Lrrk1	A	T	7: 66,290,908		probably null	Het
Man2b2	G	A	5: 36,816,198	S58L	probably benign	Het
Masp1	T	A	16: 23,458,138	H539L	probably benign	Het
Med1	G	A	11: 98,156,904	P1022L	probably damaging	Het
Meis1	T	A	11: 19,011,360	H171L	probably damaging	Het
Mier1	T	A	4: 103,155,623		probably benign	Het
Mkl2	C	T	16: 13,412,526	T1025I	possibly damaging	Het
Mmp13	A	T	9: 7,272,929	R96S	probably damaging	Het
Mms19	G	A	19: 41,953,734	T38I	probably damaging	Het
Mrc1	G	A	2: 14,310,032	C976Y	probably damaging	Het
Naalad2	A	G	9: 18,385,895	Y32H	probably benign	Het
Ndufs1	A	G	1: 63,143,926		probably benign	Het
Nefm	C	T	14: 68,124,159	D219N	probably damaging	Het
Nwd1	C	T	8: 72,662,337	P172L	probably damaging	Het
Nwd2	T	A	5: 63,805,111	D679E	probably damaging	Het
Ogdh	T	A	11: 6,339,936		probably benign	Het
Olfm3	T	A	3: 115,122,681	S421T	possibly damaging	Het
Olfr1281	A	T	2: 111,329,328	N303I	probably benign	Het
Olfr1445	T	C	19: 12,884,079	L66P	probably damaging	Het
Olfr1445	A	G	19: 12,884,546	T222A	probably damaging	Het
Olfr559	T	A	7: 102,724,029	I154F	probably damaging	Het
Olfr628	T	C	7: 103,732,376	V150A	probably benign	Het
Olfr988	A	G	2: 85,353,749	M59T	possibly damaging	Het
Opn5	T	G	17: 42,592,953	T164P	possibly damaging	Het
Pde7b	C	T	10: 20,438,746	V166M	probably damaging	Het
Pik3ap1	T	C	19: 41,324,564	N370S	probably damaging	Het
Pld1	A	G	3: 28,120,822	I90V	possibly damaging	Het
Plxna2	A	G	1: 194,644,348	T197A	possibly damaging	Het
Plxna4	A	T	6: 32,202,119	M987K	probably benign	Het
Pmch	A	G	10: 88,091,359	N75D	probably benign	Het
Prom2	T	A	2: 127,532,867	Q583L	possibly damaging	Het
Pyroxd1	T	A	6: 142,353,562	M148K	possibly damaging	Het
R3hdm2	C	T	10: 127,457,700	L158F	probably damaging	Het
Rapgef6	A	T	11: 54,625,963	T349S	probably benign	Het
Rfx5	C	T	3: 94,956,355	T105I	probably damaging	Het
Rif1	C	A	2: 52,110,737	P1401Q	probably damaging	Het
Robo3	G	A	9: 37,416,759		probably benign	Het
Rpn1	T	A	6: 88,090,242	S195T	probably benign	Het
Rslcan18	C	A	13: 67,102,119	K17N	probably benign	Het
Rsph3b	A	T	17: 6,941,727	I48N	probably damaging	Het
Sbf2	A	T	7: 110,399,343	Y628N	probably damaging	Het
Sis	T	C	3: 72,960,296	T139A	probably benign	Het
Slc22a14	A	G	9: 119,172,034		probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Smarcb1	T	C	10: 75,897,066	T372A	probably damaging	Het
Spidr	T	A	16: 16,037,667	H328L	probably damaging	Het
Sun5	T	A	2: 153,870,952	D16V	probably damaging	Het
Syde2	G	A	3: 146,014,380	E1053K	possibly damaging	Het
Syne2	T	C	12: 76,099,464	S6419P	probably damaging	Het
Tenm3	G	A	8: 48,341,160		probably benign	Het
Timm44	C	A	8: 4,260,532	E407*	probably null	Het
Tmem189	A	T	2: 167,644,987		probably benign	Het
Tnpo2	A	G	8: 85,047,362	T342A	probably benign	Het
Trio	A	G	15: 27,767,907	C1964R	probably benign	Het
Trip11	A	C	12: 101,885,672	L711R	probably damaging	Het
Trp53bp1	A	T	2: 121,269,969	H101Q	probably damaging	Het
Trpm6	A	G	19: 18,873,902		probably benign	Het
Ttn	A	T	2: 76,849,991		probably benign	Het
Ucp1	T	A	8: 83,295,307	M256K	possibly damaging	Het
Uhrf1bp1l	T	C	10: 89,791,443	S145P	probably damaging	Het
Unc5a	T	A	13: 55,004,954	S838T	probably damaging	Het
Uxs1	T	C	1: 43,764,886		probably null	Het
Vmn2r108	A	T	17: 20,462,834	C703S	possibly damaging	Het
Zc3hav1	C	T	6: 38,332,664	G408R	probably damaging	Het
Zfp609	G	A	9: 65,703,462	L740F	possibly damaging	Het
Zfp69	T	C	4: 120,931,095	E341G	probably damaging	Het
Zfp707	A	T	15: 75,975,256	H312L	probably damaging	Het
Zfp773	T	C	7: 7,133,024	D191G	probably benign	Het
Zgrf1	C	A	3: 127,573,238	D755E	probably benign	Het
Zscan5b	T	A	7: 6,239,075	I431N	probably damaging	Het

Other mutations in Pkhd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Pkhd1l1	APN	15	44477586	missense	probably damaging	1.00
IGL00235:Pkhd1l1	APN	15	44556019	missense	probably damaging	1.00
IGL00264:Pkhd1l1	APN	15	44491029	missense	possibly damaging	0.67
IGL00537:Pkhd1l1	APN	15	44591992	missense	possibly damaging	0.88
IGL00537:Pkhd1l1	APN	15	44500047	missense	probably benign	0.42
IGL00580:Pkhd1l1	APN	15	44586474	missense	probably damaging	0.98
IGL01085:Pkhd1l1	APN	15	44562752	splice site	probably null
IGL01089:Pkhd1l1	APN	15	44483869	splice site	probably benign
IGL01094:Pkhd1l1	APN	15	44546929	missense	probably benign	0.09
IGL01120:Pkhd1l1	APN	15	44505312	critical splice donor site	probably null
IGL01307:Pkhd1l1	APN	15	44530029	missense	possibly damaging	0.82
IGL01362:Pkhd1l1	APN	15	44532982	missense	probably benign	0.00
IGL01403:Pkhd1l1	APN	15	44483833	nonsense	probably null
IGL01546:Pkhd1l1	APN	15	44566316	missense	probably damaging	1.00
IGL01596:Pkhd1l1	APN	15	44529410	missense	possibly damaging	0.50
IGL01696:Pkhd1l1	APN	15	44529351	missense	possibly damaging	0.79
IGL01844:Pkhd1l1	APN	15	44499400	splice site	probably benign
IGL02007:Pkhd1l1	APN	15	44533733	splice site	probably benign
IGL02041:Pkhd1l1	APN	15	44493056	splice site	probably null
IGL02171:Pkhd1l1	APN	15	44516146	missense	possibly damaging	0.80
IGL02206:Pkhd1l1	APN	15	44512849	missense	probably benign	0.08
IGL02266:Pkhd1l1	APN	15	44573614	missense	probably damaging	1.00
IGL02487:Pkhd1l1	APN	15	44459426	missense	possibly damaging	0.65
IGL02488:Pkhd1l1	APN	15	44558597	missense	probably benign
IGL02522:Pkhd1l1	APN	15	44555902	missense	possibly damaging	0.71
IGL02554:Pkhd1l1	APN	15	44578500	missense	probably damaging	1.00
IGL02566:Pkhd1l1	APN	15	44526054	splice site	probably null
IGL02602:Pkhd1l1	APN	15	44557931	missense	probably damaging	1.00
IGL02606:Pkhd1l1	APN	15	44589456	missense	probably benign	0.00
IGL02623:Pkhd1l1	APN	15	44584873	missense	probably damaging	1.00
IGL02634:Pkhd1l1	APN	15	44539667	missense	probably damaging	1.00
IGL02637:Pkhd1l1	APN	15	44564324	missense	probably damaging	1.00
IGL02651:Pkhd1l1	APN	15	44483814	missense	probably damaging	1.00
IGL02679:Pkhd1l1	APN	15	44530045	critical splice donor site	probably null
IGL02684:Pkhd1l1	APN	15	44516209	critical splice donor site	probably null
IGL02739:Pkhd1l1	APN	15	44540950	missense	probably benign	0.11
IGL02831:Pkhd1l1	APN	15	44501493	missense	probably benign	0.18
IGL02839:Pkhd1l1	APN	15	44529543	missense	probably damaging	0.98
IGL02944:Pkhd1l1	APN	15	44501531	missense	probably damaging	1.00
IGL02957:Pkhd1l1	APN	15	44512908	missense	probably damaging	1.00
IGL03001:Pkhd1l1	APN	15	44558004	missense	probably damaging	1.00
IGL03030:Pkhd1l1	APN	15	44591976	missense	probably benign	0.00
IGL03030:Pkhd1l1	APN	15	44596902	missense	probably benign	0.41
IGL03132:Pkhd1l1	APN	15	44574617	missense	probably damaging	1.00
IGL03194:Pkhd1l1	APN	15	44518135	missense	probably damaging	1.00
IGL03219:Pkhd1l1	APN	15	44596895	missense	possibly damaging	0.62
IGL03236:Pkhd1l1	APN	15	44581826	missense	probably damaging	1.00
IGL03266:Pkhd1l1	APN	15	44538952	missense	probably damaging	1.00
IGL03276:Pkhd1l1	APN	15	44594584	missense	possibly damaging	0.77
IGL03284:Pkhd1l1	APN	15	44547518	splice site	probably benign
IGL03377:Pkhd1l1	APN	15	44484351	splice site	probably null
R0310_Pkhd1l1_251	UTSW	15	44522738	splice site	probably benign
R0344_Pkhd1l1_462	UTSW	15	44597011	missense	probably benign	0.15
R1737_Pkhd1l1_815	UTSW	15	44547509	critical splice donor site	probably null
R5049_Pkhd1l1_556	UTSW	15	44457616	missense	probably benign	0.00
K7371:Pkhd1l1	UTSW	15	44537442	missense	possibly damaging	0.67
K7371:Pkhd1l1	UTSW	15	44500067	missense	possibly damaging	0.94
N/A - 287:Pkhd1l1	UTSW	15	44582258	missense	probably damaging	0.98
P4717OSA:Pkhd1l1	UTSW	15	44523499	missense	probably benign	0.17
P4717OSA:Pkhd1l1	UTSW	15	44528247	missense	probably damaging	1.00
R0007:Pkhd1l1	UTSW	15	44574398	splice site	probably benign
R0020:Pkhd1l1	UTSW	15	44556872	missense	probably damaging	1.00
R0034:Pkhd1l1	UTSW	15	44504009	missense	probably benign	0.00
R0040:Pkhd1l1	UTSW	15	44573625	missense	probably damaging	1.00
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0050:Pkhd1l1	UTSW	15	44573807	missense	possibly damaging	0.79
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0063:Pkhd1l1	UTSW	15	44529237	missense	probably damaging	1.00
R0086:Pkhd1l1	UTSW	15	44556008	missense	possibly damaging	0.94
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0103:Pkhd1l1	UTSW	15	44597141	missense	probably benign
R0127:Pkhd1l1	UTSW	15	44554605	missense	probably damaging	0.99
R0226:Pkhd1l1	UTSW	15	44526784	missense	possibly damaging	0.65
R0268:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0294:Pkhd1l1	UTSW	15	44560435	missense	probably benign	0.05
R0310:Pkhd1l1	UTSW	15	44522738	splice site	probably benign
R0344:Pkhd1l1	UTSW	15	44597011	missense	probably benign	0.15
R0449:Pkhd1l1	UTSW	15	44501519	missense	probably damaging	1.00
R0492:Pkhd1l1	UTSW	15	44519690	missense	probably benign	0.03
R0529:Pkhd1l1	UTSW	15	44526754	missense	possibly damaging	0.62
R0543:Pkhd1l1	UTSW	15	44523491	critical splice acceptor site	probably null
R0552:Pkhd1l1	UTSW	15	44489546	missense	probably damaging	0.98
R0558:Pkhd1l1	UTSW	15	44484424	missense	probably damaging	0.97
R0609:Pkhd1l1	UTSW	15	44467424	missense	possibly damaging	0.48
R0619:Pkhd1l1	UTSW	15	44483838	missense	probably damaging	1.00
R0727:Pkhd1l1	UTSW	15	44535788	missense	possibly damaging	0.80
R0787:Pkhd1l1	UTSW	15	44529264	missense	probably damaging	1.00
R0846:Pkhd1l1	UTSW	15	44495597	missense	probably damaging	1.00
R0909:Pkhd1l1	UTSW	15	44538883	splice site	probably null
R0942:Pkhd1l1	UTSW	15	44532959	missense	probably benign	0.01
R1056:Pkhd1l1	UTSW	15	44591964	missense	probably damaging	1.00
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1147:Pkhd1l1	UTSW	15	44537441	missense	probably null	0.15
R1187:Pkhd1l1	UTSW	15	44498051	missense	possibly damaging	0.65
R1328:Pkhd1l1	UTSW	15	44497996	missense	probably benign	0.01
R1331:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1331:Pkhd1l1	UTSW	15	44589597	missense	probably damaging	1.00
R1332:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1335:Pkhd1l1	UTSW	15	44505547	missense	probably damaging	1.00
R1338:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1440:Pkhd1l1	UTSW	15	44540988	splice site	probably benign
R1445:Pkhd1l1	UTSW	15	44505644	missense	probably benign	0.32
R1458:Pkhd1l1	UTSW	15	44516115	missense	probably benign	0.01
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1469:Pkhd1l1	UTSW	15	44536886	missense	probably benign	0.45
R1500:Pkhd1l1	UTSW	15	44545494	missense	probably damaging	1.00
R1528:Pkhd1l1	UTSW	15	44526724	missense	probably damaging	1.00
R1542:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R1568:Pkhd1l1	UTSW	15	44545501	splice site	probably null
R1571:Pkhd1l1	UTSW	15	44526841	missense	probably benign
R1572:Pkhd1l1	UTSW	15	44543473	missense	probably benign	0.01
R1604:Pkhd1l1	UTSW	15	44467367	nonsense	probably null
R1638:Pkhd1l1	UTSW	15	44597117	missense	probably benign	0.06
R1639:Pkhd1l1	UTSW	15	44540955	missense	probably damaging	0.99
R1737:Pkhd1l1	UTSW	15	44547509	critical splice donor site	probably null
R1816:Pkhd1l1	UTSW	15	44528239	missense	possibly damaging	0.91
R1826:Pkhd1l1	UTSW	15	44503345	missense	possibly damaging	0.75
R1880:Pkhd1l1	UTSW	15	44525242	missense	probably benign	0.13
R1930:Pkhd1l1	UTSW	15	44503337	missense	possibly damaging	0.69
R1933:Pkhd1l1	UTSW	15	44540884	missense	possibly damaging	0.48
R1938:Pkhd1l1	UTSW	15	44500038	missense	probably benign
R1975:Pkhd1l1	UTSW	15	44529713	missense	probably damaging	1.00
R1999:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2037:Pkhd1l1	UTSW	15	44568221	splice site	probably null
R2045:Pkhd1l1	UTSW	15	44479654	missense	probably damaging	1.00
R2049:Pkhd1l1	UTSW	15	44547513	splice site	probably benign
R2049:Pkhd1l1	UTSW	15	44581741	missense	probably damaging	1.00
R2063:Pkhd1l1	UTSW	15	44550752	missense	possibly damaging	0.69
R2072:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2073:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2075:Pkhd1l1	UTSW	15	44558639	missense	probably damaging	1.00
R2078:Pkhd1l1	UTSW	15	44527767	missense	probably benign	0.08
R2116:Pkhd1l1	UTSW	15	44569482	missense	probably damaging	0.97
R2133:Pkhd1l1	UTSW	15	44516185	missense	possibly damaging	0.91
R2138:Pkhd1l1	UTSW	15	44501457	missense	probably damaging	1.00
R2139:Pkhd1l1	UTSW	15	44529818	missense	possibly damaging	0.46
R2145:Pkhd1l1	UTSW	15	44512877	splice site	probably null
R2150:Pkhd1l1	UTSW	15	44499982	splice site	probably null
R2177:Pkhd1l1	UTSW	15	44459395	missense	probably benign
R2184:Pkhd1l1	UTSW	15	44499296	missense	possibly damaging	0.89
R2216:Pkhd1l1	UTSW	15	44573895	missense	probably damaging	1.00
R2226:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2227:Pkhd1l1	UTSW	15	44512792	missense	possibly damaging	0.79
R2243:Pkhd1l1	UTSW	15	44546927	missense	probably damaging	1.00
R2290:Pkhd1l1	UTSW	15	44528250	missense	probably benign	0.03
R2294:Pkhd1l1	UTSW	15	44479607	missense	probably damaging	0.99
R2346:Pkhd1l1	UTSW	15	44560506	missense	possibly damaging	0.82
R2356:Pkhd1l1	UTSW	15	44533019	missense	probably benign	0.00
R2386:Pkhd1l1	UTSW	15	44528178	missense	probably benign	0.00
R2404:Pkhd1l1	UTSW	15	44550820	missense	probably damaging	1.00
R2504:Pkhd1l1	UTSW	15	44485428	missense	probably damaging	0.97
R2679:Pkhd1l1	UTSW	15	44545386	missense	probably damaging	0.99
R2860:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2861:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2862:Pkhd1l1	UTSW	15	44540871	missense	probably damaging	1.00
R2972:Pkhd1l1	UTSW	15	44547248	missense	possibly damaging	0.65
R3016:Pkhd1l1	UTSW	15	44545370	missense	probably benign	0.02
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3162:Pkhd1l1	UTSW	15	44505528	missense	probably damaging	1.00
R3416:Pkhd1l1	UTSW	15	44547364	missense	probably damaging	1.00
R3623:Pkhd1l1	UTSW	15	44526869	missense	probably damaging	1.00
R3687:Pkhd1l1	UTSW	15	44546587	missense	probably benign	0.17
R3755:Pkhd1l1	UTSW	15	44589406	missense	probably damaging	1.00
R3776:Pkhd1l1	UTSW	15	44514975	critical splice donor site	probably null
R3803:Pkhd1l1	UTSW	15	44493135	missense	probably benign	0.25
R3942:Pkhd1l1	UTSW	15	44592026	critical splice donor site	probably null
R4010:Pkhd1l1	UTSW	15	44529100	missense	possibly damaging	0.80
R4049:Pkhd1l1	UTSW	15	44498557	missense	probably damaging	1.00
R4059:Pkhd1l1	UTSW	15	44550760	missense	probably benign	0.01
R4179:Pkhd1l1	UTSW	15	44523649	missense	probably benign	0.45
R4184:Pkhd1l1	UTSW	15	44591906	missense	probably benign	0.00
R4369:Pkhd1l1	UTSW	15	44505553	missense	probably benign	0.00
R4462:Pkhd1l1	UTSW	15	44581804	missense	probably damaging	1.00
R4551:Pkhd1l1	UTSW	15	44550885	missense	probably damaging	1.00
R4618:Pkhd1l1	UTSW	15	44539682	missense	probably damaging	1.00
R4632:Pkhd1l1	UTSW	15	44484400	missense	probably benign	0.07
R4657:Pkhd1l1	UTSW	15	44547347	missense	probably damaging	1.00
R4716:Pkhd1l1	UTSW	15	44556032	missense	probably damaging	1.00
R4788:Pkhd1l1	UTSW	15	44498021	missense	probably damaging	0.99
R4828:Pkhd1l1	UTSW	15	44529405	missense	possibly damaging	0.55
R4858:Pkhd1l1	UTSW	15	44491101	missense	probably damaging	0.99
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4860:Pkhd1l1	UTSW	15	44537378	missense	possibly damaging	0.77
R4951:Pkhd1l1	UTSW	15	44533891	missense	possibly damaging	0.82
R4963:Pkhd1l1	UTSW	15	44504025	missense	probably benign	0.00
R5023:Pkhd1l1	UTSW	15	44528191	missense	probably benign	0.44
R5023:Pkhd1l1	UTSW	15	44582227	missense	probably benign	0.00
R5035:Pkhd1l1	UTSW	15	44568324	missense	probably damaging	1.00
R5049:Pkhd1l1	UTSW	15	44457616	missense	probably benign	0.00
R5065:Pkhd1l1	UTSW	15	44582293	missense	possibly damaging	0.68
R5089:Pkhd1l1	UTSW	15	44591887	missense	probably benign	0.01
R5151:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5153:Pkhd1l1	UTSW	15	44505309	missense	probably benign	0.00
R5189:Pkhd1l1	UTSW	15	44547148	missense	probably damaging	1.00
R5204:Pkhd1l1	UTSW	15	44547041	missense	possibly damaging	0.51
R5216:Pkhd1l1	UTSW	15	44495647	nonsense	probably null
R5286:Pkhd1l1	UTSW	15	44514972	nonsense	probably null
R5292:Pkhd1l1	UTSW	15	44529566	missense	probably damaging	1.00
R5293:Pkhd1l1	UTSW	15	44535750	missense	probably benign	0.01
R5298:Pkhd1l1	UTSW	15	44504046	missense	probably benign	0.00
R5327:Pkhd1l1	UTSW	15	44546862	missense	probably damaging	1.00
R5346:Pkhd1l1	UTSW	15	44540967	missense	probably damaging	1.00
R5481:Pkhd1l1	UTSW	15	44558646	missense	probably damaging	1.00
R5645:Pkhd1l1	UTSW	15	44532992	missense	probably benign	0.18
R5718:Pkhd1l1	UTSW	15	44545417	missense	probably damaging	1.00
R5809:Pkhd1l1	UTSW	15	44519707	missense	probably benign	0.03
R5816:Pkhd1l1	UTSW	15	44566322	missense	probably benign	0.01
R5854:Pkhd1l1	UTSW	15	44581790	missense	probably damaging	1.00
R5876:Pkhd1l1	UTSW	15	44578588	missense	possibly damaging	0.51
R5909:Pkhd1l1	UTSW	15	44526763	missense	probably damaging	1.00
R5950:Pkhd1l1	UTSW	15	44532965	missense	probably benign	0.00
R5961:Pkhd1l1	UTSW	15	44459463	missense	probably damaging	1.00
R5972:Pkhd1l1	UTSW	15	44545416	missense	probably damaging	1.00
R5975:Pkhd1l1	UTSW	15	44525988	missense	probably damaging	1.00
R5982:Pkhd1l1	UTSW	15	44489504	splice site	probably null
R6066:Pkhd1l1	UTSW	15	44528129	missense	probably damaging	0.99
R6122:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6248:Pkhd1l1	UTSW	15	44529559	missense	probably benign
R6294:Pkhd1l1	UTSW	15	44570028	missense	probably damaging	1.00
R6301:Pkhd1l1	UTSW	15	44589525	missense	probably damaging	0.99
R6526:Pkhd1l1	UTSW	15	44498089	critical splice donor site	probably null
R6707:Pkhd1l1	UTSW	15	44529143	missense	probably benign
R6736:Pkhd1l1	UTSW	15	44557940	missense	probably damaging	1.00
R6753:Pkhd1l1	UTSW	15	44589663	missense	probably benign	0.45
R6815:Pkhd1l1	UTSW	15	44562655	missense	probably damaging	1.00
R6874:Pkhd1l1	UTSW	15	44589527	missense	probably benign	0.06
R6942:Pkhd1l1	UTSW	15	44522629	missense	probably damaging	1.00
R6970:Pkhd1l1	UTSW	15	44511674	missense	possibly damaging	0.61
R6982:Pkhd1l1	UTSW	15	44566268	missense	probably damaging	0.97
R7103:Pkhd1l1	UTSW	15	44573631	missense	probably benign	0.02
R7116:Pkhd1l1	UTSW	15	44557976	missense	probably benign	0.00
R7135:Pkhd1l1	UTSW	15	44584978	critical splice donor site	probably null
R7143:Pkhd1l1	UTSW	15	44573637	missense	possibly damaging	0.93
R7177:Pkhd1l1	UTSW	15	44467404	missense	probably damaging	1.00
R7194:Pkhd1l1	UTSW	15	44529116	missense	probably damaging	1.00
R7204:Pkhd1l1	UTSW	15	44523553	missense	possibly damaging	0.90
R7215:Pkhd1l1	UTSW	15	44528163	missense	possibly damaging	0.78
R7218:Pkhd1l1	UTSW	15	44522695	missense	possibly damaging	0.49
R7225:Pkhd1l1	UTSW	15	44546941	missense	probably damaging	1.00
R7283:Pkhd1l1	UTSW	15	44503280	missense	probably benign	0.10
R7292:Pkhd1l1	UTSW	15	44498590	missense	probably benign
R7304:Pkhd1l1	UTSW	15	44498482	missense	possibly damaging	0.94
R7349:Pkhd1l1	UTSW	15	44514954	missense	probably damaging	1.00
R7359:Pkhd1l1	UTSW	15	44589486	missense	probably damaging	1.00
R7407:Pkhd1l1	UTSW	15	44595011	missense	possibly damaging	0.75
R7475:Pkhd1l1	UTSW	15	44505185	nonsense	probably null
R7481:Pkhd1l1	UTSW	15	44512911	missense	probably benign
R7554:Pkhd1l1	UTSW	15	44495470	missense	probably damaging	1.00
R7555:Pkhd1l1	UTSW	15	44550761	missense	possibly damaging	0.51
R7562:Pkhd1l1	UTSW	15	44514930	missense	possibly damaging	0.68
R7583:Pkhd1l1	UTSW	15	44568364	critical splice donor site	probably null
R7595:Pkhd1l1	UTSW	15	44495521	missense	probably damaging	1.00
R7749:Pkhd1l1	UTSW	15	44527737	missense	probably benign	0.00
R7754:Pkhd1l1	UTSW	15	44586408	missense	possibly damaging	0.94
R7761:Pkhd1l1	UTSW	15	44529884	missense	probably benign	0.00
R7774:Pkhd1l1	UTSW	15	44540907	missense	probably benign	0.03
R7785:Pkhd1l1	UTSW	15	44543569	missense	probably damaging	1.00
R7790:Pkhd1l1	UTSW	15	44578581	missense	probably damaging	1.00
R7804:Pkhd1l1	UTSW	15	44597138	nonsense	probably null
R7864:Pkhd1l1	UTSW	15	44526053	critical splice donor site	probably null
R7883:Pkhd1l1	UTSW	15	44529126	missense	probably damaging	1.00
R8031:Pkhd1l1	UTSW	15	44512834	missense	probably damaging	1.00
R8128:Pkhd1l1	UTSW	15	44498053	missense	possibly damaging	0.94
R8142:Pkhd1l1	UTSW	15	44514931	missense	probably benign	0.00
R8150:Pkhd1l1	UTSW	15	44546659	missense	possibly damaging	0.68
R8209:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8212:Pkhd1l1	UTSW	15	44499300	missense	probably benign	0.12
R8226:Pkhd1l1	UTSW	15	44574407	missense	possibly damaging	0.46
R8248:Pkhd1l1	UTSW	15	44543546	missense	probably damaging	0.99
R8299:Pkhd1l1	UTSW	15	44581934	missense	probably benign	0.26
R8425:Pkhd1l1	UTSW	15	44574515	missense	probably benign	0.01
R8485:Pkhd1l1	UTSW	15	44560400	missense	probably damaging	0.98
R8486:Pkhd1l1	UTSW	15	44547416	missense	probably damaging	1.00
R8701:Pkhd1l1	UTSW	15	44574683	missense	probably damaging	1.00
R8709:Pkhd1l1	UTSW	15	44518174	missense	probably benign	0.01
R8777:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8777-TAIL:Pkhd1l1	UTSW	15	44498571	missense	probably damaging	1.00
R8845:Pkhd1l1	UTSW	15	44505254	missense	probably benign	0.30
R8846:Pkhd1l1	UTSW	15	44546962	nonsense	probably null
R8863:Pkhd1l1	UTSW	15	44569986	nonsense	probably null
R8917:Pkhd1l1	UTSW	15	44533007	missense	probably benign	0.04
R8936:Pkhd1l1	UTSW	15	44538916	missense	possibly damaging	0.94
R8962:Pkhd1l1	UTSW	15	44536895	missense	probably damaging	1.00
R8971:Pkhd1l1	UTSW	15	44529519	missense	possibly damaging	0.68
R8973:Pkhd1l1	UTSW	15	44586437	missense	probably damaging	1.00
R8982:Pkhd1l1	UTSW	15	44523673	nonsense	probably null
R8994:Pkhd1l1	UTSW	15	44547103	missense	probably damaging	0.99
R9004:Pkhd1l1	UTSW	15	44543372	missense	probably benign	0.16
R9064:Pkhd1l1	UTSW	15	44562642	missense	possibly damaging	0.93
R9173:Pkhd1l1	UTSW	15	44520756	missense	probably benign	0.09
R9185:Pkhd1l1	UTSW	15	44589623	missense	probably benign	0.01
R9213:Pkhd1l1	UTSW	15	44495478	missense	probably damaging	1.00
R9218:Pkhd1l1	UTSW	15	44520726	missense	possibly damaging	0.90
R9256:Pkhd1l1	UTSW	15	44533894	critical splice donor site	probably null
R9291:Pkhd1l1	UTSW	15	44569976	missense	probably damaging	1.00
R9309:Pkhd1l1	UTSW	15	44536893	missense	probably benign	0.00
R9319:Pkhd1l1	UTSW	15	44529578	missense	possibly damaging	0.46
R9339:Pkhd1l1	UTSW	15	44589553	missense	probably damaging	1.00
R9366:Pkhd1l1	UTSW	15	44546912	missense	probably benign	0.03
R9444:Pkhd1l1	UTSW	15	44554657	missense	probably benign	0.00
R9464:Pkhd1l1	UTSW	15	44479613	missense	probably damaging	1.00
R9525:Pkhd1l1	UTSW	15	44584926	missense	possibly damaging	0.88
R9542:Pkhd1l1	UTSW	15	44546888	missense	probably benign	0.12
R9544:Pkhd1l1	UTSW	15	44546843	missense	probably damaging	1.00
R9608:Pkhd1l1	UTSW	15	44578633	missense	possibly damaging	0.65
R9673:Pkhd1l1	UTSW	15	44523505	missense	probably benign	0.22
R9771:Pkhd1l1	UTSW	15	44495487	missense	probably benign
R9792:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9793:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
R9795:Pkhd1l1	UTSW	15	44543587	missense	probably benign	0.00
RF006:Pkhd1l1	UTSW	15	44503238	missense	probably benign	0.03
RF006:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF008:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF012:Pkhd1l1	UTSW	15	44558505	critical splice acceptor site	probably benign
RF019:Pkhd1l1	UTSW	15	44558507	critical splice acceptor site	probably benign
RF030:Pkhd1l1	UTSW	15	44558502	critical splice acceptor site	probably benign
RF033:Pkhd1l1	UTSW	15	44558506	critical splice acceptor site	probably benign
RF038:Pkhd1l1	UTSW	15	44558503	critical splice acceptor site	probably benign
RF046:Pkhd1l1	UTSW	15	44558495	critical splice acceptor site	probably benign
X0027:Pkhd1l1	UTSW	15	44591966	missense	probably damaging	0.99
Z1177:Pkhd1l1	UTSW	15	44573576	missense	probably damaging	0.97
Z1177:Pkhd1l1	UTSW	15	44578578	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTGCTCTTTTAAGCATCGGCATCT -3'
(R):5'- TCTGCTGACACGGATTTTGTCACTT -3'

Sequencing Primer
(F):5'- CGGCATCTAGTACTGCAGAAAT -3'
(R):5'- CGGATTTTGTCACTTGGTATTTTTAG -3'

Posted On

2013-06-12