Incidental Mutation 'R0506:Ttll4'
ID 47541
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R0506 (G1)
Quality Score 219
Status Validated
Chromosome 1
Chromosomal Location 74700804-74740991 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 74727777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 846 (D846E)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: D846E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: D846E

low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113678
AA Change: D782E
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: D782E

low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140591
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

low complexity region 56 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155753
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74,725,052 (GRCm39) missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74,727,352 (GRCm39) missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74,718,217 (GRCm39) missense probably benign 0.01
IGL02288:Ttll4 APN 1 74,718,560 (GRCm39) missense probably benign 0.05
IGL02621:Ttll4 APN 1 74,726,643 (GRCm39) missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74,726,390 (GRCm39) splice site probably null
IGL02890:Ttll4 APN 1 74,726,498 (GRCm39) nonsense probably null
IGL02937:Ttll4 APN 1 74,718,662 (GRCm39) missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74,719,567 (GRCm39) missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74,726,480 (GRCm39) missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74,729,139 (GRCm39) missense probably null 1.00
R0083:Ttll4 UTSW 1 74,718,928 (GRCm39) missense probably benign 0.13
R0108:Ttll4 UTSW 1 74,718,928 (GRCm39) missense probably benign 0.13
R0135:Ttll4 UTSW 1 74,719,087 (GRCm39) missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74,718,851 (GRCm39) missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74,735,916 (GRCm39) missense probably benign 0.28
R0555:Ttll4 UTSW 1 74,727,439 (GRCm39) missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74,718,560 (GRCm39) missense probably benign 0.05
R1649:Ttll4 UTSW 1 74,736,629 (GRCm39) missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74,726,999 (GRCm39) missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74,736,641 (GRCm39) missense probably benign 0.01
R1952:Ttll4 UTSW 1 74,726,718 (GRCm39) missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74,724,527 (GRCm39) missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74,724,527 (GRCm39) missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74,719,541 (GRCm39) missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74,725,550 (GRCm39) missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74,718,988 (GRCm39) missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74,725,597 (GRCm39) splice site probably null
R2876:Ttll4 UTSW 1 74,725,597 (GRCm39) splice site probably null
R2895:Ttll4 UTSW 1 74,724,517 (GRCm39) missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74,724,517 (GRCm39) missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74,736,770 (GRCm39) missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74,725,550 (GRCm39) missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74,718,445 (GRCm39) missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74,727,011 (GRCm39) critical splice donor site probably null
R5244:Ttll4 UTSW 1 74,735,607 (GRCm39) missense probably benign 0.30
R5264:Ttll4 UTSW 1 74,725,535 (GRCm39) missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74,718,480 (GRCm39) missense probably benign 0.06
R5992:Ttll4 UTSW 1 74,724,550 (GRCm39) missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74,736,698 (GRCm39) missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74,720,948 (GRCm39) missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74,720,512 (GRCm39) missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74,718,508 (GRCm39) missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74,728,572 (GRCm39) missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74,720,975 (GRCm39) missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74,727,820 (GRCm39) missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74,726,418 (GRCm39) missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74,718,572 (GRCm39) missense probably benign 0.00
R7837:Ttll4 UTSW 1 74,720,916 (GRCm39) critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74,735,632 (GRCm39) missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74,718,389 (GRCm39) missense probably benign 0.02
R8115:Ttll4 UTSW 1 74,726,489 (GRCm39) nonsense probably null
R8949:Ttll4 UTSW 1 74,720,975 (GRCm39) missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74,718,949 (GRCm39) missense probably benign 0.02
R9156:Ttll4 UTSW 1 74,719,225 (GRCm39) missense probably benign 0.00
R9329:Ttll4 UTSW 1 74,725,121 (GRCm39) missense possibly damaging 0.85
R9701:Ttll4 UTSW 1 74,720,482 (GRCm39) missense probably benign 0.07
R9802:Ttll4 UTSW 1 74,720,482 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gaatcctaagccccaaactaaatac -3'
Posted On 2013-06-12