Incidental Mutation 'R5294:Ube2c'
ID475429
Institutional Source Beutler Lab
Gene Symbol Ube2c
Ensembl Gene ENSMUSG00000001403
Gene Nameubiquitin-conjugating enzyme E2C
Synonyms1110015A16Rik, D2Ertd695e
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164769898-164778822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164777190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 161 (V161A)
Ref Sequence ENSEMBL: ENSMUSP00000001439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001439] [ENSMUST00000088248] [ENSMUST00000103095]
Predicted Effect probably benign
Transcript: ENSMUST00000001439
AA Change: V161A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001439
Gene: ENSMUSG00000001403
AA Change: V161A

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 170 8.8e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088248
SMART Domains Protein: ENSMUSP00000085581
Gene: ENSMUSG00000001403

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 175 1.88e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103095
SMART Domains Protein: ENSMUSP00000099384
Gene: ENSMUSG00000017300

DomainStartEndE-ValueType
EFh 19 47 2.44e-5 SMART
EFh 55 83 8.31e-8 SMART
EFh 95 123 2.01e-6 SMART
EFh 131 159 8.06e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155443
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is required for the destruction of mitotic cyclins and for cell cycle progression, and may be involved in cancer progression. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been defined on chromosomes 4, 14, 15, 18, and 19. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Ube2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ube2c APN 2 164771293 missense probably benign 0.00
IGL01619:Ube2c APN 2 164771312 missense probably damaging 1.00
R1726:Ube2c UTSW 2 164771317 missense probably damaging 1.00
R1748:Ube2c UTSW 2 164771321 missense probably damaging 1.00
R1854:Ube2c UTSW 2 164771362 missense probably damaging 0.99
R1864:Ube2c UTSW 2 164770023 missense probably benign 0.13
R4624:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4627:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4628:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4629:Ube2c UTSW 2 164772173 missense possibly damaging 0.73
R4810:Ube2c UTSW 2 164772562 makesense probably null
R7763:Ube2c UTSW 2 164771291 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GACCATTTGTCCAGTTGCCC -3'
(R):5'- TGGGGCTGGGAATAGACTAAATTC -3'

Sequencing Primer
(F):5'- CAGTTGCCCACTGCTAGC -3'
(R):5'- TAACGAGTAGGCACCCGCTG -3'
Posted On2017-04-19