Incidental Mutation 'R5133:Kmt5b'
ID475464
Institutional Source Beutler Lab
Gene Symbol Kmt5b
Ensembl Gene ENSMUSG00000045098
Gene Namelysine methyltransferase 5B
SynonymsC630029K18Rik, Suv420h1, Suv4-20h1
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5133 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3767421-3818303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3802240 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 159 (H159Q)
Ref Sequence ENSEMBL: ENSMUSP00000109610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005518] [ENSMUST00000052699] [ENSMUST00000113968] [ENSMUST00000113970] [ENSMUST00000113972] [ENSMUST00000113973] [ENSMUST00000113974] [ENSMUST00000113977] [ENSMUST00000152935] [ENSMUST00000176262] [ENSMUST00000176926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005518
AA Change: H182Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005518
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 4e-37 BLAST
SET 199 315 3.46e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052699
AA Change: H182Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060162
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 1e-36 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113968
AA Change: H182Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109601
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 4e-37 BLAST
SET 199 315 3.46e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113970
AA Change: H182Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109603
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 1e-36 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113972
AA Change: H182Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109605
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 1e-34 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 536 547 N/A INTRINSIC
low complexity region 814 846 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113973
AA Change: H182Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109606
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 1e-34 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 536 547 N/A INTRINSIC
low complexity region 814 846 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113974
AA Change: H159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109607
Gene: ENSMUSG00000045098
AA Change: H159Q

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113977
AA Change: H159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109610
Gene: ENSMUSG00000045098
AA Change: H159Q

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135586
Predicted Effect probably damaging
Transcript: ENSMUST00000152935
AA Change: H140Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115984
Gene: ENSMUSG00000045098
AA Change: H140Q

DomainStartEndE-ValueType
Blast:SET 16 84 9e-39 BLAST
PDB:3S8P|B 22 212 1e-139 PDB
Blast:SET 157 212 4e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176125
Predicted Effect probably damaging
Transcript: ENSMUST00000176262
AA Change: H159Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135563
Gene: ENSMUSG00000045098
AA Change: H159Q

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176926
AA Change: H182Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135756
Gene: ENSMUSG00000045098
AA Change: H182Q

DomainStartEndE-ValueType
Blast:SET 58 126 3e-36 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a SET domain. SET domains appear to be protein-protein interaction domains that mediate interactions with a family of proteins that display similarity with dual-specificity phosphatases (dsPTPases). The function of this gene has not been determined. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are born at sub-Mendelian ratios, are smaller than control littermates, and die within a few hours of birth, probably due to alveolar defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cmya5 T C 13: 93,093,372 K1736R possibly damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fbn2 T C 18: 58,039,340 D2131G probably damaging Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il17ra A G 6: 120,481,553 E555G possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setbp1 A G 18: 78,857,482 I990T probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Kmt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Kmt5b APN 19 3786618 missense possibly damaging 0.86
IGL02005:Kmt5b APN 19 3786538 missense possibly damaging 0.50
IGL02058:Kmt5b APN 19 3793181 missense probably damaging 1.00
IGL02069:Kmt5b APN 19 3807335 missense probably damaging 1.00
IGL02395:Kmt5b APN 19 3814887 missense probably benign 0.01
IGL02701:Kmt5b APN 19 3796681 missense probably benign 0.08
loony UTSW 19 3804501 missense possibly damaging 0.79
Tunes UTSW 19 3802799 nonsense probably null
P0047:Kmt5b UTSW 19 3793223 splice site probably benign
R0127:Kmt5b UTSW 19 3786465 start codon destroyed probably null 0.99
R1574:Kmt5b UTSW 19 3786633 splice site probably null
R1574:Kmt5b UTSW 19 3786633 splice site probably null
R1797:Kmt5b UTSW 19 3814833 missense probably benign 0.03
R2178:Kmt5b UTSW 19 3815372 missense possibly damaging 0.68
R2418:Kmt5b UTSW 19 3807266 missense probably benign 0.00
R4290:Kmt5b UTSW 19 3802193 missense possibly damaging 0.51
R4789:Kmt5b UTSW 19 3815330 missense probably benign 0.00
R4939:Kmt5b UTSW 19 3815245 missense possibly damaging 0.88
R5392:Kmt5b UTSW 19 3802127 missense possibly damaging 0.84
R5568:Kmt5b UTSW 19 3786538 missense probably benign 0.00
R6029:Kmt5b UTSW 19 3802104 missense probably damaging 0.99
R6184:Kmt5b UTSW 19 3804499 missense probably damaging 1.00
R6649:Kmt5b UTSW 19 3807295 missense probably damaging 0.96
R7043:Kmt5b UTSW 19 3815220 missense possibly damaging 0.47
R7131:Kmt5b UTSW 19 3815412 missense probably benign 0.00
R7203:Kmt5b UTSW 19 3814147 missense probably damaging 1.00
R7287:Kmt5b UTSW 19 3804501 missense possibly damaging 0.79
R7468:Kmt5b UTSW 19 3802799 nonsense probably null
R7850:Kmt5b UTSW 19 3815043 missense probably damaging 1.00
R8103:Kmt5b UTSW 19 3815381 missense probably benign 0.00
R8334:Kmt5b UTSW 19 3814795 missense probably benign 0.00
R8336:Kmt5b UTSW 19 3815531 missense probably damaging 1.00
Z1176:Kmt5b UTSW 19 3793118 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACTCAGGTTCAGTTCTAGTAC -3'
(R):5'- TCACGAACATTCAGGCTTCG -3'

Sequencing Primer
(F):5'- TGGTGCACATATACGCATGC -3'
(R):5'- ACGAACATTCAGGCTTCGGTTTAC -3'
Posted On2017-04-24