Incidental Mutation 'R0506:Ifi207'
ID 47547
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Name interferon activated gene 207
Synonyms AI607873, Pyhin-A
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0506 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 173550993-173569313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 173563878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 47 (Q47L)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
AlphaFold E9Q3L4
Predicted Effect possibly damaging
Transcript: ENSMUST00000042610
AA Change: Q47L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: Q47L

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127730
AA Change: Q47L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: Q47L

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173,552,610 (GRCm39) missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173,564,007 (GRCm39) missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173,551,314 (GRCm39) missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173,555,159 (GRCm39) missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173,562,670 (GRCm39) splice site probably benign
PIT4458001:Ifi207 UTSW 1 173,562,738 (GRCm39) missense unknown
R0043:Ifi207 UTSW 1 173,556,678 (GRCm39) missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173,563,964 (GRCm39) missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173,557,431 (GRCm39) missense possibly damaging 0.85
R0843:Ifi207 UTSW 1 173,555,143 (GRCm39) missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173,562,861 (GRCm39) missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173,557,913 (GRCm39) missense unknown
R1462:Ifi207 UTSW 1 173,552,513 (GRCm39) missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173,552,513 (GRCm39) missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173,557,629 (GRCm39) missense unknown
R1502:Ifi207 UTSW 1 173,556,872 (GRCm39) missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173,555,306 (GRCm39) missense probably benign 0.30
R1831:Ifi207 UTSW 1 173,559,992 (GRCm39) missense unknown
R1928:Ifi207 UTSW 1 173,557,211 (GRCm39) missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173,562,805 (GRCm39) missense probably benign 0.01
R2132:Ifi207 UTSW 1 173,557,337 (GRCm39) missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173,564,036 (GRCm39) splice site probably benign
R3703:Ifi207 UTSW 1 173,555,029 (GRCm39) nonsense probably null
R3741:Ifi207 UTSW 1 173,555,128 (GRCm39) missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173,562,869 (GRCm39) missense probably benign 0.33
R4747:Ifi207 UTSW 1 173,556,633 (GRCm39) missense probably benign 0.00
R4772:Ifi207 UTSW 1 173,555,253 (GRCm39) missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173,557,622 (GRCm39) missense unknown
R4855:Ifi207 UTSW 1 173,557,381 (GRCm39) missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173,558,064 (GRCm39) missense unknown
R5244:Ifi207 UTSW 1 173,557,503 (GRCm39) missense probably benign 0.04
R5280:Ifi207 UTSW 1 173,557,870 (GRCm39) missense unknown
R5301:Ifi207 UTSW 1 173,556,977 (GRCm39) missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173,555,097 (GRCm39) missense probably benign 0.21
R5445:Ifi207 UTSW 1 173,555,363 (GRCm39) missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173,559,992 (GRCm39) missense unknown
R5838:Ifi207 UTSW 1 173,559,953 (GRCm39) missense unknown
R6060:Ifi207 UTSW 1 173,558,093 (GRCm39) missense unknown
R6220:Ifi207 UTSW 1 173,557,112 (GRCm39) missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173,555,111 (GRCm39) missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173,552,619 (GRCm39) missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173,557,532 (GRCm39) missense probably benign 0.01
R6394:Ifi207 UTSW 1 173,556,581 (GRCm39) missense probably benign 0.43
R6532:Ifi207 UTSW 1 173,557,211 (GRCm39) missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173,556,972 (GRCm39) missense probably benign 0.01
R6893:Ifi207 UTSW 1 173,555,208 (GRCm39) missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173,557,818 (GRCm39) missense unknown
R7192:Ifi207 UTSW 1 173,556,584 (GRCm39) missense not run
R7194:Ifi207 UTSW 1 173,557,490 (GRCm39) missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173,556,581 (GRCm39) missense probably benign 0.43
R7348:Ifi207 UTSW 1 173,556,762 (GRCm39) small deletion probably benign
R7404:Ifi207 UTSW 1 173,556,494 (GRCm39) missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173,554,997 (GRCm39) missense probably benign 0.03
R7784:Ifi207 UTSW 1 173,557,698 (GRCm39) missense unknown
R8041:Ifi207 UTSW 1 173,555,268 (GRCm39) missense possibly damaging 0.78
R8116:Ifi207 UTSW 1 173,557,746 (GRCm39) missense unknown
R8166:Ifi207 UTSW 1 173,557,504 (GRCm39) missense probably benign 0.10
R8166:Ifi207 UTSW 1 173,557,166 (GRCm39) missense possibly damaging 0.95
R8168:Ifi207 UTSW 1 173,557,504 (GRCm39) missense probably benign 0.10
R8383:Ifi207 UTSW 1 173,556,770 (GRCm39) small deletion probably benign
R8388:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R8389:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R8390:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R8399:Ifi207 UTSW 1 173,557,844 (GRCm39) missense unknown
R8431:Ifi207 UTSW 1 173,558,070 (GRCm39) missense unknown
R8474:Ifi207 UTSW 1 173,556,605 (GRCm39) missense possibly damaging 0.63
R8505:Ifi207 UTSW 1 173,557,016 (GRCm39) frame shift probably null
R9009:Ifi207 UTSW 1 173,555,382 (GRCm39) missense probably damaging 0.97
R9061:Ifi207 UTSW 1 173,564,153 (GRCm39) intron probably benign
R9071:Ifi207 UTSW 1 173,557,764 (GRCm39) missense unknown
R9090:Ifi207 UTSW 1 173,556,762 (GRCm39) small deletion probably benign
R9323:Ifi207 UTSW 1 173,555,143 (GRCm39) missense probably damaging 1.00
R9407:Ifi207 UTSW 1 173,555,234 (GRCm39) missense probably damaging 1.00
R9493:Ifi207 UTSW 1 173,556,522 (GRCm39) missense probably benign 0.00
R9629:Ifi207 UTSW 1 173,556,561 (GRCm39) small deletion probably benign
RF009:Ifi207 UTSW 1 173,556,558 (GRCm39) missense probably benign 0.00
RF011:Ifi207 UTSW 1 173,556,687 (GRCm39) missense not run
RF032:Ifi207 UTSW 1 173,562,723 (GRCm39) small deletion probably benign
X0003:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173,556,548 (GRCm39) missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173,557,145 (GRCm39) missense probably damaging 1.00
Z1187:Ifi207 UTSW 1 173,558,093 (GRCm39) missense unknown
Z1192:Ifi207 UTSW 1 173,558,093 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GACACTGGTAGGACTGGGGTTCTC -3'
(R):5'- ACCAGGAGTCAGGATCTGACAGGC -3'

Sequencing Primer
(F):5'- GGGTTCTCTGTTTCAAGTTACC -3'
(R):5'- GTTCTGGCACAGAGGAATATCTCC -3'
Posted On 2013-06-12