Incidental Mutation 'R5143:Plppr5'
ID475470
Institutional Source Beutler Lab
Gene Symbol Plppr5
Ensembl Gene ENSMUSG00000033342
Gene Namephospholipid phosphatase related 5
Synonyms4833424O15Rik, Lppr5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5143 (G1)
Quality Score140
Status Not validated
Chromosome3
Chromosomal Location117574836-117689507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117625903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 207 (T207A)
Ref Sequence ENSEMBL: ENSMUSP00000102081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039564] [ENSMUST00000106473]
Predicted Effect probably benign
Transcript: ENSMUST00000039564
AA Change: T207A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045121
Gene: ENSMUSG00000033342
AA Change: T207A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106473
AA Change: T207A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102081
Gene: ENSMUSG00000033342
AA Change: T207A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,739,198 probably null Het
Abcc2 T C 19: 43,821,661 I886T probably benign Het
Adrb2 T C 18: 62,178,776 Y326C probably damaging Het
AF366264 A G 8: 13,836,844 S416P possibly damaging Het
Aplp1 G A 7: 30,441,123 R334C probably damaging Het
AY358078 T C 14: 51,802,549 S39P unknown Het
Bpifb2 A T 2: 153,878,504 D61V probably damaging Het
Caap1 A T 4: 94,501,382 N238K probably damaging Het
Cfap54 A G 10: 93,029,158 V726A possibly damaging Het
Chrna7 T C 7: 63,106,147 Y217C probably damaging Het
Crocc T A 4: 141,041,039 T414S probably benign Het
Cyp2a12 A G 7: 27,036,611 I482V probably benign Het
Dnah6 A T 6: 73,181,761 F620I possibly damaging Het
Eogt A G 6: 97,125,584 L256P probably damaging Het
F5 A G 1: 164,211,828 I2002M probably damaging Het
Foxp1 A G 6: 98,945,532 probably null Het
Fut8 A G 12: 77,365,209 D111G probably benign Het
Gm17689 T A 9: 36,581,904 N41Y probably benign Het
Golgb1 C T 16: 36,898,689 A319V probably benign Het
Hoxd3 C T 2: 74,746,372 R39C probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Olfr690 T A 7: 105,329,524 I223F probably damaging Het
Pcdhb2 A G 18: 37,296,732 Y586C probably damaging Het
Plcd1 G A 9: 119,074,451 Q442* probably null Het
Pomt1 C A 2: 32,254,329 A709E probably benign Het
Prmt8 A G 6: 127,732,714 M61T probably benign Het
Ptpn23 A G 9: 110,385,438 probably benign Het
Sbf2 T A 7: 110,422,540 K493* probably null Het
Tmc2 A T 2: 130,234,818 S355C probably damaging Het
Tonsl A G 15: 76,636,657 S399P possibly damaging Het
Ttc14 T C 3: 33,808,901 probably benign Het
Ttn A G 2: 76,738,065 S19168P probably damaging Het
Usp17lb A T 7: 104,841,478 S80T probably damaging Het
Vmn2r96 A G 17: 18,583,858 I457V possibly damaging Het
Wdr64 G T 1: 175,726,413 D170Y probably damaging Het
Zbtb42 T C 12: 112,679,514 V41A probably damaging Het
Other mutations in Plppr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plppr5 APN 3 117671943 missense possibly damaging 0.46
IGL01081:Plppr5 APN 3 117686649 utr 3 prime probably benign
IGL01315:Plppr5 APN 3 117662526 missense probably damaging 1.00
IGL02802:Plppr5 UTSW 3 117662579 missense probably damaging 1.00
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0332:Plppr5 UTSW 3 117671932 missense probably benign 0.05
R0757:Plppr5 UTSW 3 117575891 missense probably benign 0.16
R1101:Plppr5 UTSW 3 117662523 missense probably damaging 0.99
R1354:Plppr5 UTSW 3 117575847 missense possibly damaging 0.94
R1498:Plppr5 UTSW 3 117662612 missense probably damaging 0.97
R1967:Plppr5 UTSW 3 117625906 critical splice donor site probably null
R2090:Plppr5 UTSW 3 117575871 missense possibly damaging 0.63
R4661:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
R5441:Plppr5 UTSW 3 117662471 missense possibly damaging 0.94
R5722:Plppr5 UTSW 3 117621065 missense probably benign 0.00
R6560:Plppr5 UTSW 3 117671990 missense probably benign 0.09
R7221:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
Z1177:Plppr5 UTSW 3 117625779 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCTAGCTCCACACTTTCTGG -3'
(R):5'- ATGACCTTAAGAGAGCCAGCTG -3'

Sequencing Primer
(F):5'- CACACTTTCTGGCTTTGTGTAAG -3'
(R):5'- GCCAGCTGAGTTAATATTATCACAG -3'
Posted On2017-04-24