Incidental Mutation 'R5026:Cd4'
ID475482
Institutional Source Beutler Lab
Gene Symbol Cd4
Ensembl Gene ENSMUSG00000023274
Gene NameCD4 antigen
SynonymsL3T4, Ly-4
MMRRC Submission 042617-MU
Accession Numbers

Genbank: NM_013488; MGI: 88335

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5026 (G1)
Quality Score21
Status Validated
Chromosome6
Chromosomal Location124864692-124888221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124866620 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 443 (T443A)
Ref Sequence ENSEMBL: ENSMUSP00000024044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000204667]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024044
AA Change: T443A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274
AA Change: T443A

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046893
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204253
Predicted Effect probably benign
Transcript: ENSMUST00000204667
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

 All alleles(25) : Targeted(13) Gene trapped(6) Spontaneous(2) Chemically induced(4)          

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
Brsk1 A T 7: 4,704,266 R273W probably damaging Het
C2cd3 T A 7: 100,459,842 M2259K possibly damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Map1a T G 2: 121,307,538 S2660A possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Sez6 T A 11: 77,968,989 F378Y probably damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tial1 C T 7: 128,448,396 E82K probably damaging Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in Cd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
seshat APN 6 124872977 missense possibly damaging 0.81
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
Doubles UTSW 6 124872458 missense probably benign 0.01
fourless UTSW 6 124870244 critical splice donor site probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
R7943:Cd4 UTSW 6 124870244 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATTGGTACCTCAGGGCAC -3'
(R):5'- AACAGATGTCACTGACAGGAC -3'

Sequencing Primer
(F):5'- TCTGTGCAGACCCAGAGG -3'
(R):5'- CAGGACGGGGGCTTAAGC -3'
Posted On2017-04-28